... Alexei Lidov.. ... The creation of sacred space as a form of creativity and subject of cultural history .. ... 91 Mikhail V. Bibikov Byzantine Eden: "time in space" .. ... 140 Svetlana Popovi The Byzantine Monastery: its Spatial Iconography and the Question of Sacredness .. ... 525 762 Milena Rozhdestvenskaya The Creation of Sacred Space in Medieval Russian Literature: apocrypha and chronicles .. ... 556 Vladimir V. Sedov The Sacred Space of the Medieval Russian Church: the Architectural Aspect .. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>26) - imk.msu.ru/ )

• Èíñòèòóò ìèðîâîé êóëüòóðû ÌÃÓ

... PDF created with pdfFactory trial version www.pdffactory.com 2 . ... 2001. ... 1977. ... 1987. ... 1983, 1987. ... 1985. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>24) - dynamo.geol.msu.ru/ )

... Project developer: Serguey Lonchakov, 4th year student, and Serguey Azarkin, 3rd year student . ... The project is working on creating a robot-platform which performs hopping movement, an absolutely new principle of movement for automatons. ... However, if for an adult walking, running, jumping or climbing do not seem to cause any problem, but two-legged robots have just caught up with average speed of a human being, and that is after 20 years of work. ... And the robot started hopping. ... Jumping ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>21) - engineering.phys.msu.ru/ )

• Circuit Diagnostics

... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode ­ computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>32) - www.elch.chem.msu.ru/ )

... Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. We have grown up in the laboratory of laser spectroscopy of water media. ... Use of such powerful modern tools of solution of inverse problems and problems of optimization provides successful solution of a wide range of applied problems of diagnostics and analysis of water media. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>25) - rswater.phys.msu.ru/ )

Ïîäêëþ÷åíèå êëèåíòà OS/2 ê ñåòè . Óñòàíîâèì Peer (âåðñèÿ 1). ... Ïîÿâèòñÿ ÷åðíîå îêîøêî, ñîîáùàþùåå, ÷òî êîïèðóþòñÿ âðåìåííûå ôàéëû. Ïîÿâèòñÿ îêíî "IBM Peer for OS/2 Installation/Configuration" ñ áîëüøèì ëîãîòèïîì IBM. Íàæèìàåì êíîïêó "OK". ... Âûáèðàåì "Install/configure this workstation." ... Îêíî "Select Network Adapter" . ... Îêíî "Other Network Adapter Files" . ... Îïÿòü ïîÿâèòñÿ îêíî "Select Network Adapter" . ... Íåîáõîäèìî ââåñòè èìÿ êîìïüþòåðà, ïîä êîòîðûì îí áóäåò âèäåí â ñåòè. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>22) - www.kge.msu.ru/ )

• Ñåðâåðíûå ôóíêöèè OS/2

... Nonlinear spectroscopy . Nonlinear fiber optics . Attosecond optics . ... qqqqqqqqqqqq Rapidly progressing fiber-optic technologies open new avenues in biophotonics, providing an advanced platform for the creation of novel fiber-based imaging systems optical endoscopes, biophotonics-oriented fiber laser sources and optical neural interfaces. ... Êàê ïðàâèëî áîëåå òî÷íûå ìåòîäû ðåãèñòðàöèè èîííûõ òîêîâ (ñ ïîìîùüþ ýëåêòðîäîâ) ñèëüíåå îãðàíè÷åíû ïî ÷èñëó îäíîâðåìåííî ðåãèñòðèðóåìûõ íåéðîíîâ. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>7) - photonicslab.phys.msu.ru/ )

... News . For 1st and 2nd-year students . Introduction to quantum physics . ... About us . ... Create new account (active tab) . ... Request new password . E-mail * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Create new account . ... 2003 2016 Department of Quantum Electronics . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>6) - quantum.phys.msu.ru/ )

... Our primary objective is the design and implementation of applied software tools for data processing, output and circulation of computer literature. ... Software tools for signal processing in medicine and engineering CONAN-m and CONAN-t. Statistical stable analysis tool for regression and factor models SIGN. ... Figurnov V.A. "IBM PC for Users" (in Russian). ... Boldin M.V., Simonova G.I., Tyurin Yu.N. "Sign Statistical Analysis of Linear Models" (in Russian and in English ). ... InCo . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>3) - statsoft.msu.ru/ )

... x25BA; Login to the site . Skip to create new account . Login here using your username and password . ... Username . Password . ... Some courses may allow guest access . ... For full access to courses you'll need to take a minute to create a new account for yourself on this web site. ... You can now access the full course. From now on you will only need to enter your personal username and password (in the form on this page) to log in and access any course you have enrolled in. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>2) - moodle.ffl.msu.ru/ )

... x25BA; Login to the site . Skip to create new account . Login here using your username and password . ... Username . Password . ... Some courses may allow guest access . ... For full access to courses you'll need to take a minute to create a new account for yourself on this web site. ... You can now access the full course. From now on you will only need to enter your personal username and password (in the form on this page) to log in and access any course you have enrolled in. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>3) - www.kids.genebee.msu.ru/ )

... Data . ... Meteor-M òÄÖ1 . ... Meteor-M òÄÖ2 . ... Solar energetic particles . ... Solar flare database (RU) . ... Developers: David Parunakian, Wera Barinova, Oleg Barinov, Ludmila Mukhametdinova . Database administration: Sergey Bobrovnikov, Wera Barinova . Space physics models: Alexey Petrov, Rikho Nymmik , Boris Yushkov, Shugai Julia, Kuznetsov, Suvorova . ... Developed in 2007. Copyright ˆé 2007 - 2016 Skobeltsyn Institute of Nuclear Physics Moscow State University Feedback ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>32) - smdc.sinp.msu.ru/ )

• Scientific services - Space monitoring data center
• OMNIweb mirror - Space monitoring data center
• Space monitoring data center

. Name . Last Modified . Size . Type . Parent Directory / . - . Directory . 10.2 / . 2009-Dec-06 17:59:27 . - . Directory . lighttpd/1.4.37

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>33) - curl.sai.msu.ru/ )

• Index of /pub/mirror/opensuse/

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Departments . ... Field training . ... The department curriculum is focused on preparation of experts of the top skills in the field of tourist business, tourist service, the government in tourism sphere. ... A theme of scientific work of department Territorial touristic-recreational systems: natural and social and economic preconditions of a sustainable development includes three underthemes. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>49) - eng.geogr.msu.ru/ )

• Undergraduate study

... The Laboratory of Programming Technologies was established in 2001. The Laboratory's team consists of collaborators and graduate students of Computer System Automation Department that work under supervision of Professor Igor Mashechkin. ... series of works for research and development of multi-functional cross-programming system. ... Presently the main scientific direction of the Laboratory is research and development of algorithms and methods for creating data mining software. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>137) - en.cs.msu.ru/ )

• Laboratory of Programming Technologies | CMC MSU
• Department of Supercomputers and Quantum Informatics | CMC MSU
• Department of System Programming | CMC MSU

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MÀire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>34) - ideas.msu.ru/ )

• http://ideas.msu.ru/news/19_10_2010/Press_release.pdf

I. (SCIENCE CITATION INDEX ­SCI) WEB OF SCIENCE Web of Science (WoS) , , , , , Web of Science. ... Search>. ... WEB OF SCIENCE (SCIENCE CITATION INDEX) , Web of Science <Cited Reference Search>, , <Search>. ... Russian Acad Sci, Boreskov Inst Catalysis, Siberian Branch; - RAS, Boreskov Inst Catalysis SB; - SB RAS, Boreskov Inst Catalysis; - Boreskov Inst Catalysis; - Inst Catalysis; - Novosibirsk Catalysis Inst; - Boreskov Inst Catalysis SB RAS; - Boreskov Catalysis Inst; - GK Boreskov Inst Catalysis. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>42) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/courses/crchem/urusov2.pdf

... Custom Query . ... Component . ... automata io requirements ui . ... And š Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . Or š Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . ... Summary Component Milestone Status Owner Type Priority Resolution Created Modified Blocked By Blocking Reporter Keywords Cc . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>688) - kodomo.cmm.msu.su/ )

• Custom Query â?' Cyclyc Cell Automata

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>23) - mouse.genebee.msu.ru/ )

... 379.08 KB . ... 362.46 KB . ... 372.72 KB . ... 380.65 KB . ... 373.13 KB . ... 366.63 KB . ... 374.91 KB . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>307) - www.geogr.msu.ru/ )

• CONTENT 3à(8)à2015
• CONTENT 1 (4) 2011
• louis vuitton replica purse wholesale louis vuitton outlets cheap sales