... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>3) - lcc.chem.msu.ru/ )

... ICONO Symposium on Femtosecond Laser Pulse Filamentation . Co-Chairs: Sea Leang Chin (Laval Univ., ... Russia) . ... In the past 15 years, he turned his attention to study the physics and applications of femtosecond laser filamentation in all optical materials, in particular, in air and is one of the leading scientists in this field. ... INVITED : в?? ... Efficient THz generation by optical rectification of femtosecond laser pulses and application of THz radiation for plasma investigation в??, ...

Еще в разделе: (Показать все результаты (>6) - iconolat13.phys.msu.ru/ )

• Invited speakers
• Excursions

... However, our studies show that Prosilica EC650 has very good p erformance to use as DIMM image detector. ... The sub-directories /opt/dimm/data/out for the output data file, /opt/dimm/data/log for the output log file yymmdd-dimm.log and /opt/dimm/etc for the configuration file must b e created. ... Pictures mode The Pictures mode provides grabbing of the star b ox images and storing their sequence as one output file "b oxrecord.fits" in /opt/dimm/data/images/ sub directory. ...

Еще в разделе: (Показать все результаты (>30) - curl.sai.msu.ru/ )

• Index of /pub/
• Index of /pub/mirror/
• Index of /pub/mirror/suse/

Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenkoї, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia ї Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>86) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2008/2008-kholodov-retention.pdf
• http://www.mgumus.chem.msu.ru/ihss/pdf/slovakia-2005.doc

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

Mechmath admission for internetional students . Specialist degree . ... Specialist variants . Master degree . ... Master variants . ... Scientific Research Training . ... We?ll tell you what you need to know about the Festival of Science. ... What is the Festival of Science, and why is it so attractive to all who have participated in it?both children and adults?that they look forward eagerly to each new Festival? ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>4) - pk.math.msu.ru/ )

• Mechmath admission for internetional students

High level DQ control Vladimir Kulikovskiy Data/MC 3N trigger only. ... Colas presentaAon ґ raAo seems to be different for different trigger setups. ... Wiki >Data >Quality Assessment (boYom) Ї It's a SeaTray module (antares qa used as a base) to be added in future to the producAon chain. ... Aafit charge sigma aachargesigma AafitChargePerOM RMS / MEAN * 100% Residual Residual ґ Ame(ns) difference between real hit Ame and expected hit Ame from Aafit reconstructed track. ...

Еще в разделе: (Показать все результаты (>8) - antares.sinp.msu.ru/ )

MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...

Еще в разделе: (Показать все результаты (>37) - brain.bio.msu.ru/ )

• Sergei Shishkin

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>87) - npidb.belozersky.msu.ru/ )

• Index of /data
• Index of /data/html_scop
• Index of /data/pdb_new