Общее . ... Геология в Московском университете . ... Профком геологического факультета . ... Геологический факультет МГУ всемирно известный учебно-научный центр России. ... Вся деятельность сотрудников факультета направлена на развитие геологической науки, образования и культуры необходимых условий экономического и духовного возрождения России. ... 119991, Российская Федерация, Москва, ГСП-1, Ленинские горы, Московский государственный университет имени М.В. Ломоносова, Геологический факультет, . ...

Еще в разделе: (Показать все результаты (>5) - geol.msu.ru/ )

... Nonlinear Phenomena in Bubbly Liquids . ... In particular in a result of experimental studies of intensity dynamics of laser beam scattering the idea about two-phase state of real liq-uids was formulated. Using the conservation laws of gas dynamics and assumption that nonline-arity of processes is mainly determined by the bubble dynamics the two-phase mathematical model for average pressure and volumetric concentration of gas phase was suggested. ...

Еще в разделе: (Показать все результаты (>501) - acs366.phys.msu.su/ )

• ISNA-16
• Abstract

EUROPEAN C O MM ISS ION Community r esear c h FP7 in Brief How to get involved in the EU 7th Framework Programme for Research a pocket guide for newcomers Europe Direct is a service to help you find answers to your questions about the European Union Free phone number from any Member State: 00 800 6 7 8 9 10 11 Chargeable number from anywhere else in the world. ... In order to complement national research programmes, activities funded from FP7 must have a "European added value". ...

Еще в разделе: (Показать все результаты (>37) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/press_release_StG_2012.pdf
• http://ideas.msu.ru/docs/AdG_call_2010.pdf
• http://ideas.msu.ru/docs/h2020presentationRU.pdf

... Antal , T.K., Volgusheva , A.A., Kukarskih , G.P., Krendeleva , T.E., Rubin, A.B. Relationships between H 2 photoproduction and different electron transport pathways in sulfur-deprived Chlamydomonas reinhardtii (2009) International Journal of Hydrogen Energy, 34, pp. ... Antal , T.K., Volgusheva , A.A., Kukarskikh , G.P., Krendeleva , T.E., Tusov , V.B., Rubin, A.B. Examination of chlorophyll fluorescence in sulfur-deprived cells of Chlamydomonas reinhardtii (2006) Biofizika ., 51 (2), pp. ...

Еще в разделе: (Показать все результаты (>10) - biophys.msu.ru/ )

• A.B.Rubin - Curriculum vita
• CURRICULUM VITAE

... pobedria@member.ams.org . ... Since that time he has read the following courses of lectures: Mechanics of Continuous Media, Numerical Methods, Classical Mechanics, Mechanics of Solids, Theory of Elasticity and Plasticity, Tensor Analysis, Theory of Viscoelasticity, Composites Mechanics, Stability of deformation processes, Mathematical theory of Shells, Dynamic problems of the Composites Mechanics. ... Member of the European Community on Computational Methods in Applied Sciences (ECCOMAS)(1996) . ...

Еще в разделе: (Показать все результаты (>4) - composite.msu.ru/ )

• Department of the Composites Mechanics
• INTAS 95-525 Final Reprort (Short version)

... The main field of my investigations is stellar spectrophotometry. As a result of scientific activity of our group spectrophotometric catalog was created including energy distribution data on 900 stars in the range 3200-7600AA and 250 stars in the range 6000-10800AA (Voloshina et al., Spectrophotometry of Bright Stars, ed. I.N.Glushneva, 1982, Moscow, Nauka, in Russian). ...

Еще в разделе: (Показать все результаты (>24) - uranus.sai.msu.ru/ )

• Eugene Trunkovsky

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>153) - www.genebee.msu.ru/ )

• AliGraf - GeneBee Graphical Alignment Help
• Databases
• AliComp - GeneBee Alignment Comparison Help

... Next: Index Up: Scanning Probe Microscopy Image Previous: COM-port initialization file format Contents Index . Figure D.1: Parameters of 3D Images . ... Intensity of material emission (Mat. ... material color for diffused light (Mat. ... material reflection color for directed light (Mat. ... material reflection color for reflected light (Mat. ... intensity of directed light (Light Diffuse) . ... Material Shininess) In our case we use the model, where , and this parameter is called Material Color. ...

Еще в разделе: (Показать все результаты (>47) - www.spm.genebee.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>11) - npidb.belozersky.msu.ru/ )

• Index of /data/pdb_new/scop_contact_type

... Seminar archive . ... Type Ia Supernovae (SNe Ia) have an important role to measure a distance to an anonymous galaxy because they have a good correlation of the decline rates of the light curves with the absolute luminosity. ... First, super-Chandrasekhar SNe which have extremely high luminosity, slow decline rate of the light curves, slow expansion velocity and strong carbon features. ... As another example of diversity of SNe Ia, I would like also to introduce Type Iax SNe. ... All seminars: . ...

Еще в разделе: (Показать все результаты (>306) - master.sai.msu.ru/ )

• SAI Space Monitoring Laboratory
• Общемосковский семинар астрофизиков имени Якова Борисовича Зельдовича

Experimental Collaborations . Leading particles" -- E852 -- CMS -- "The Hall D Project" . Scintillation Magnetic Spectrometer MSU": experimental setup . ... fixed target experiment to trace the evolution of transient non-equilibrium hadronic states, as they penetrate through the nuclear matter . an experiment in the polarized proton beam to investigate spin phenomena in the proton-nucleus interactions . ... Participants from Hadronic Interactions Laboratory: . ...

Еще в разделе: (Показать все результаты (>61) - lav01.sinp.msu.ru/ )

... A.V. Tikhonravov, Ph.D., Professor . Research Computing Center, Lomonosov Moscow State University, Moscow, Russia; . ... Professor, Research Computing Center, Lomonosov Moscow State University, Moscow, Russia; . ... Faculty of Mechanics and Mathematics, Lomonosov Moscow State University, Moscow, Russia; . ... Faculty of Computational Mathematics and Cybernetics, Lomonosov Moscow State University, Moscow, Russia; . ... Faculty of Physics , Lomonosov Moscow State University, Moscow, Russia; . ...

Еще в разделе: (Показать все результаты (>325) - num-meth.srcc.msu.ru/ )

• Supercomputer molecular modeling of thermodynamic equilibrium in gas-metal
• Numerical Methods and Programming.Advanced Computing
• "ALIGNMENT IN FREE DECAYING MHD TURBULENCE"

... Information for the applicants . ... News . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Faculty of Bioengineering and Bioinformatics, office 433. ... 2016 Faculty of Bioengineering and Bioinformatics, . Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>12) - en.fbb.msu.ru/ )

• Information for the applicants? Faculty of Bioengineering and Bioinformatics,
• Information for the applicantsтАФ Faculty of Bioengineering and Bioinformatics,
• Background? Faculty of Bioengineering and Bioinformatics, MSU

. ИМЕЕТСЯ РУССКАЯ ВЕРСИЯ . Moscow State University . Chamber Orchestra . founded in 1967 by Edward Gindin . music director, Alexander Konstantinov . About the Orchestra . MEMBERS: . 201 5 /201 6 season . Alia . RECITALS: . Concert Schedule . Audio/Video Records . Some Other Interesting Sites . Natalya Atsarkina , site administrator ( e-mail: azarkina@yahoo.com ) . The homepage was founded in September, 1999 . Lastly updated in March 22, 201 6 . This site is a member of WebRing. To browse visit Here .

Еще в разделе: (Показать все результаты (>21) - music.genebee.msu.ru/ )

• MSU Chamber Orchestra. Hystory.
• MSU Chamber Orchestra. Alia.
• MSU Chamber Orchestra. Members.

Title Authors Key words Methodological bases of personal qualities research of managers and personnel selection for the public service, security personnel, managers of industrial enterprises A.A. Oseev, A.A. Oseev personal qualities of effective leaders of the civil service, the security sector, industrial enterprises , verification of Weber 's types of social action in empirical models of ...

Еще в разделе: (Показать все результаты (>33) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2015/3/07.pdf
• Вестник МГУ

МГУ имени М.В.Ломоносова Русская версия . ... Sociology . ... Chairman Dean of the Faculty of Sociology of the Lomonosov Moscow State University, Doctor of Sociology , Professor Osipova N.G. Vice-Chairman Vice-Dean for Science of the Faculty of Sociology of the Lomonosov Moscow State University, Candidate of Political Sciences, Associated Professor Kanevskiy P.S. Executive secretary Chairman of the Young Scientists Council of the Faculty of Sociology of the Lomonosov ...

Еще в разделе: (Показать все результаты (>80) - conf.msu.ru/ )

... Nonlinear fiber optics . ... member of the Editorial Board for the Laser Physics journal . ... Member of the steering committee of the international conference on Raman spectroscopy (ICORS): Budapest, 2002; Brisbane, 2004; Yokohama, 2006; London, 2008 . Member of the steering committee of the International Laser Physics workshop: Bratislava, 2002; Hamburg, 2003; Trieste, 2004; Kyoto, 2005; Lausanne, 2006; Leon, 2007; Trondheim, 2008; Barcelona, 2009 . ... International conference ?Laser Optics? ...

Еще в разделе: (Показать все результаты (>11) - photonicslab.phys.msu.ru/ )

119. http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf

120. http://www.mce.biophys.msu.ru/archive/doc101522/doc.pdf