ISSUE 1 RUSSIA U.S. BILATERAL ON CYBERSECURITY CRITICAL TERMINOLOGY FOUNDATIONS APRIL 2011 The Russia U.S. Bilateral on Cybersecurity ­ Critical Terminology Foundations Issue 1 The principle editors of this document are: Karl Frederick Rauscher, EastWest Institute and Valery Yaschenko, Information Security Institute of Moscow State University. ... INFORMATION AND CYBER .. ... Scientific Adviser to the Director of the Lomonosov Moscow State University Institute of Information Security Issues. ...

Еще в разделе: (Показать все результаты (>24) - iisi.msu.ru/ )

ISSN 1560-3547, Regular and Chaotic Dynamics, 2015, Vol. ... 6 2015 SEQUENTIAL DYNAMICS IN THE MOTIF OF EXCITATORY COUPLED ELEMENTS 703 Then the system under study equation): 1 = = 2 3 = takes the following form (we deleted two multipliers from every (F (2 )+ F (3 ))1 (-1+2F (3 ) - 1 2 ), (F (3 )+ F (1 ))2 (-1+2F (1 ) - 2 2 ), (F (1 )+ F (2 ))3 (-1+2F (2 ) - 3 2 ). ... Vol. ... 6 2015 SEQUENTIAL DYNAMICS IN THE MOTIF OF EXCITATORY COUPLED ELEMENTS 709 function, the system takes the form (4.2). ...

Еще в разделе: (Показать все результаты (>127) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/efa/rm_70_1167.pdf
• http://ics.org.ru/upload/iblock/d2d/196-the-dynamics-and-control-of-a-spherical-robot-with-an-internal-omniwheel-platform_ru.pdf

... 2 · ­ , , · ­ · ­ , 03.12.2015 . ... 14 03.12.2015 · · · 03.12.2015 . ... Verifier Uni ve rsi ty of Te x as 2013 Anteater Uni ve rsi ty of Il l i noi s 2011 FlowChecker Uni ve rsi ty of North Carol i na 2010 VERMONT Network disjoint Port #02 Port #03 h2 h3 s1 Port #01 h1 Port #04 h4 main: disjoint() := Forall[x, out_x, y, out_y: !R(x, out_x) or !R(y, out_y) or x[p] == out_y[p] and out_x[p] == y[p] or x VERMONT proxy CLI Packets are delivered through the control plane We can block them! ...

Еще в разделе: (Показать все результаты (>9) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf
• http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf
• http://lvk.cs.msu.su/~bahmurov/course_realtime/papers/balashov_et_al_eucass2011_monitoring.doc

... ICONO Symposium on Femtosecond Laser Pulse Filamentation . Co-Chairs: Sea Leang Chin (Laval Univ., ... Russia) . ... In the past 15 years, he turned his attention to study the physics and applications of femtosecond laser filamentation in all optical materials, in particular, in air and is one of the leading scientists in this field. ... INVITED : в?? ... Efficient THz generation by optical rectification of femtosecond laser pulses and application of THz radiation for plasma investigation в??, ...

Еще в разделе: (Показать все результаты (>13) - iconolat13.phys.msu.ru/ )

• Invited speakers
• Program topics

... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...

Еще в разделе: (Показать все результаты (>5) - ccoe.msu.ru/ )

... ATOMS, MOLECULES, OPTICS Preparation of Biphotons in Arbitrary Polarization States L. A. Krivitskioe, S. P. Kulik*, G. A. Maslennikov, and M. V. Chekhova Moscow State University, Moscow, 119992 Russia *e-mail: postmast@qopt.phys.msu.su Received October 6, 2004 Abstract--An experiment on preparation of entangled photon pairs (biphotons) in an arbitrary polarization state is described. ... As the half-wave plate was rotated, the biphoton state transformed into |0, 2 (at = 45°). ... Fig. ... 3 2005 Fig...

Еще в разделе: (Показать все результаты (>115) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/kulik/Papers/e011802.pdf
• http://qi.phys.msu.ru/kulik/Papers/JETP_Lett_03.pdf
• http://qi.phys.msu.su/papers/2006-jetp(e)-102-712.pdf

... Scientific Laboratories . Science . ... Home Science and education Scientific Laboratories Laboratory of Nonlinear Spectroscopy of Ultrafast Processes in Condensed Matter . ... Nonlinear spectroscopy of condenced matter - semiconductors, HTSC, metals, quantum-size structures, etc. ... 1995-2001: task 7.15 of the State Scientific-Technical Program "Physics of Quantum and Wave Phenomena", direction "Fundamental Spectroscopy", the Ministry of Science, Russian Federation . ...

Еще в разделе: (Показать все результаты (>216) - ilc.phys.msu.ru/ )

• Laboratory of solid-state lasers and coherent spectroscopy
• Публикация
• Publication

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

M obile A stronomical Sy stem of TE lescope- R obots MASTER-II Kislovodsk Lomonosov Moscow State University, Sternberg Astronomical Institute , Moscow Union "Optic" , Kislovodsk Solar Station Latitude = 43 o љ44'.767љN; Longitude = 42 o љ31'.417љE; Altitude = 2067љm MASTERљIIљ(8љsquareљdegress) + MASTERљVWF(VeryљWideљFieldљCameras (FOV=800 square degrees, Timeљresolutionљupљtoљ150љms, with unfiltered m_lim=14m on 5 sec. exposure, and ~10.5m with 0.15 sec) . ... 11h 38m 38.0s , -09d 59m 59s) . ...

Еще в разделе: (Показать все результаты (>2) - apollo.sai.msu.ru/ )

... 2 What is MATLAB ?? Basic Matrix Operations Script Files and M-files Some more Operations and Functions APPLICATIONS: Plotting functions .. ... Vectors are special forms of matrices and contain only one row OR one column. Scalars are matrices with only one row AND one column MATLAB Matrices 17 A matrix with only one row AND one column is a scalar. A scalar can be created in MATLAB as follows: » a_value=23 a_value = 23 MATLAB Matrices 18 A matrix with only one row is called a row vector. ...

Еще в разделе: (Показать все результаты (>15) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2013.PRIA.Mamaev_Lukin_Yurin.HermiteNLM.en.pdf

... Separation of all runs on several groups by mean active sectors. ... Ways to carry out step 2: trying to cut off all points which don't reach the fit line with errors. Ways to carry out step 2: mean active sectors selection Ways to carry out step 2: results of mean active sectors selection by example of set 2 Failing of mean active sector selection method on example of set 3: one point is still on the graph Introduction of new distance parameter How to find an optimal distance parameter? ...

Еще в разделе: (Показать все результаты (>25) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/Gracheva_Bamberg_22.09.11.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%202.pdf
• http://antares.sinp.msu.ru/docs/Shirokov%20-%20The%20first%20results%20of%20MSU%20groups%20in%20ANTARES%20project.pdf

HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...

Еще в разделе: (Показать все результаты (>42) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/literature/WOS.pdf

... L Сd , Pol a nd ABOUT EFFECTIVE MODES METHOD FOR DESCRIPTION OF INTERNAL DYNAMICS OF WEAKLY BOUND CLUSTERS Elena Belega, Evgeny Cheremukhin 1 , Dmitry Trubnikov Abstract: New approach to describe the internal dynamics of weakly bound clusters is presented. ... It is found that the number of active collective modes depends on the initial cluster excitation and that the internal energy is partitioned nonuniformly among the modes. ... Collective motion of oxygen atoms performs mostly in plane. ...

Еще в разделе: (Показать все результаты (>18) - beams.chem.msu.ru/ )

... активного ") элемента слоя . ... active - признак активности (чувствительности) элементов слоя к положению курсора в зависимости от состояния клавиш Shift, Ctrl, Alt. draw_active - признаки управляющие отображением активного элемента. ... активность элементов слоя независимо от состояния клавиш (Shift Ctrl Alt) . ... активность элементов слоя при нажатой клавише Shift . ... активность элементов слоя при нажатой клавише Ctrl . ... активность элементов слоя при отжатых клавишах Shift, Ctrl, Alt . ...

Еще в разделе: (Показать все результаты (>36) - adept.srcc.msu.ru/ )

• Cursor (Active)
• draw_active
• cursor-active

Общее . ... Геология в Московском университете . ... Профком геологического факультета . ... Геологический факультет МГУ всемирно известный учебно-научный центр России. ... Вся деятельность сотрудников факультета направлена на развитие геологической науки, образования и культуры необходимых условий экономического и духовного возрождения России. ... 119991, Российская Федерация, Москва, ГСП-1, Ленинские горы, Московский государственный университет имени М.В. Ломоносова, Геологический факультет, . ...

Еще в разделе: (Показать все результаты (>5) - geol.msu.ru/ )

Школа танцев Грация-МГУ . ... Грация-МГУ::Форум Общение Общение . ... Вестник тирании . ... O'Rey . Apr 20 2012, 04:15 . Сообщение #1 . born to create drama . Астрологи объявили неделю кровавой тирании. ... Любой пользователь, упомянувший в течение Недели Кровавой Тирании анатомические особенности строения женского тела, будет забанен на хренадцать дней и обретет статус-сообщение 'Похотливая самка бабуина'. ... Цитата(O'Rey @ Apr 20 2012, 05:29) . ...

Еще в разделе: (Показать все результаты (>932) - grace.msu.ru/ )

• Плохой день - Грация-МГУ::Форум
• Вся правда про белку - Грация-МГУ::Форум
• Нормы не для нас - Грация-МГУ::Форум

. People on #C4ACTbE as of 18 Jan 2001 18:45 MSK . Nickname . Status . User@Host . C4ACTbEP . idle . This is me, the channel bot. XAM[c] . idle . u0948@mvs.imm.uran.ru . Igorek . idle . igorek@kronos.psu.ru . Berendeev . - . graffity@ts16-a82.dial.sovam.com . Created by quesedilla v3 via eggdrop This page is automatically refreshed.

Еще в разделе: (Показать все результаты (>10) - asa.guru.ru/ )

. This crossword was created with EclipseCrossword - www.eclipsecrossword.com . 1 . 2 . 3 . 4 . 5 . 6 . 7 . 8 . 9 . Этот кроссворд был создан freeware EclipseCrossword

119. Summer School 2016

120. http://www.imk.msu.ru/Publications/lidov/Contents,%20Hierotopy%20collection%202006.pdf