... culmination fashion of in defiance of a mode.. ... Просмотров: 474 Тема: culmination fashion of in defiance of a mode ugg boots on purchasing like on impassion onpass on wiping out in strengthen of the amenities perquisites of в форуме: Кафедра гидрологии . ...

Еще в разделе: (Показать все результаты (>246) - www.geogr.msu.ru/ )

• kdsuous|ellakpi kdsdylu|ellahipJH (все сообщения)
• Конференция IGU
• Публикации Е.И. Поляковой за 2008-2011 гг.

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• ConClus

... The %IF% construct gives TWiki the power to include content in topics based on the value of simple expressions. ... True if the current context is set (see below) . ... Compare TWiki variable You are %IF{ "$ WIKINAME='TWikiGuest' and not defined OPEN_DAY" then="not" }% allowed to %IF{ "context view" then="view" else="edit"}% this TWiki today. ... Check access permissions You %IF{"'%TOPIC%' allows 'change'" then="can" else="cannot"}% change this topic. ... in changes script (see TWikiScripts ) . ...

Еще в разделе: (Показать все результаты (>35481) - dualopt1.cmm.msu.ru/ )

• IfStatements - TWiki - TWiki - (printable)

TUS/KLYPVE Program for Observation of Extreme Energy Cosmic Rays from Space B.A. Khrenov DV Skobeltsyn Institute of Nuclear Physics of MV Lomonosov Moscow State University Workshop "Cosmic Ray Large Scale Experiments in the Second Decade of the 21st Century" 17 May 2011 TUS/KLYPVE collaboration SINP MSU, JINR (Dubna), RSC "Energia", Consortium "Space Regatta" EWHA University (Seoul, Korea) Puebla University (Mexico) Universities of Japan, RIKEN (Tokyo). ... Digital oscilloscopes for UV flashes. ...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

• http://tunka.sinp.msu.ru/en/presentation/horns_vhe.pdf

... About lab . People . ... Online Journal "Computer graphics and multimedia" (in russian) . ... An algorithm for estimating locations of people in world coordinates and its application for tracking . ...

Еще в разделе: (Показать все результаты (>167) - graphics.cs.msu.ru/ )

• Publications | Graphics and Media Lab

... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . On mathematical creative work of L.S. Pontryagin (By D.V. Anosov) . ... L.S.Pontryagin, P.S.Alexandrov and A.N.Kolmogorov . ... Photo by A.I.Pontryagina In the beginning of the 50s, L.S. went into (broadly understood) theory of ordinary differential equations, which had episodically drawn his interest earlier. ...

Еще в разделе: (Показать все результаты (>25) - pont2008.cmc.msu.ru/ )

IEEE International Workshop on Intelligent Data Acquisition and Advanced Computing Systems: Technology and Applications 21-23 September 2009, Rende (Cosenza), Italy Web and Grid Services for Training in Earth Observation 1 Marian Neagul, Silviu Panica, Dana Petcu, Daniela Zaharie1, Dorian Gorgan 2 West University of Timisoara, Bd.V.Parvan ... CONCLU SIONS GiSHEO's platform promises to deliver real-time services for satellite data processing for training activities for Earth observation. ...

Еще в разделе: (Показать все результаты (>35) - angel.cs.msu.su/ )

... Why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... Filters are used to remove low-complexity sequence because it can cause artifactual hits (please see Q: After running a search why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ...

Еще в разделе: (Показать все результаты (>132) - www.genebee.msu.ru/ )

• Picornaviruses: discovering big in small
• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help

Journal of Magnetism and Magnetic Materials 324 (2012) 3516 -3518 Contents lists available at SciVerse ScienceDirect Journal of Magnetism and Magnetic Materials journal h o m e p age : www.elsevier .com/locate/jmmm Magneto-optical Kerr effect enhancement at the Wood's anomaly in magnetoplasmonic crystals A.V. Chetvertukhin a, A.A. Grunin a, A.V. Baryshev b, T.V. Dolgova a, H. Uchida c, M. Inoue b, A.A. Fedyanin a,n a b c Faculty of ...

Еще в разделе: (Показать все результаты (>75) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/jmmm324_3516_2012.pdf
• About the laboratory | Laboratory of Nanophotonics & Metamaterials
• About the laboratory | Лаборатория нанооптики и метаматериалов

... of engineering and ecological geology . ... Eleven scientific conferences concerning the problems of engineering geology were organized by the department of engineering and ecological geology of MSU: . ... Engineering geology of loess soils» (Int. Scientific conf., ... Presidium of conference « Engineering geology of loess soils»: professors V.A.Korolev and V.T.Trofimov , - MSU, May 2004. ... MSU, May 2004. ... Participants of the conference «Engineering geology of loess soils» - MSU, May 2004. ...

Еще в разделе: (Показать все результаты (>75) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/engeol/eng/Vasil-e.htm

News Archive . ... SUNY delegation headed by Interim Chancellor Admiral John R. Ryan to visit Moscow State University. ... The SUNY Center on the United States and Russia at Moscow State University was opened in a ceremony hosted by Rector Sadovnichy of MSU and Chancellor Robert King. ... Both sides agreed to a SUNY-MSU rematch in 2002. ... On January 15, 2001 a new MSU Co-Director of the SUNY Center on Russia and the United States, Dr. Nikolai V. Semin will begin performing his duties at the office. ...

Еще в разделе: (Показать все результаты (>16) - suny.msu.ru/ )

• Center on Russia and the United States :: Summary of SUNY/MSU Center Activities

... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>14) - uhecr.sinp.msu.ru/ )