... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• About

List of Publications . ... Odoulov S,Tarabrova T, Shumelyuk S, Naumova II, Chaplina TO: Photorefractive response of bulk periodically poled LiNbO 3 :Y:Fe at high and low spatial frequencies. ... Evlanova N.F., Naumova I.I., Chaplina T.O., Blokhin S.A. and Lavrishchev S.V. Periodically poled Y:LiNbO 3 single crystal: impurity distribution and domain wall location, Journal of Crystal Growth, Vol. 223, ? 1-2, pp 156-160 (2001). ... Phys. Rev. Lett., 86, pp 4021-402 (2001). ...

Еще в разделе: (Показать все результаты (>2) - newcryst.phys.msu.ru/ )

... General ideas of classical game-theoretic analysis: Game in normal form (as a model of players interaction) -Several participants (players) - Several possible strategies for each player -Payoff functions Principle of Nash equilibrium (as a method to define agents strategies during their interaction) -Nash equilibrium is a basic concept of game theory. ... If is not an equilibrium then mutants with pure strategy that is a best reply to have grater payoff than the average payoff for the main...

Еще в разделе: (Показать все результаты (>8) - io.cmc.msu.ru/ )

• Кафедра Исследования Операций

... The problem of behavior of lower layer of the Earth crust in the process of continental subduction was studied basing on conception of two-staged plate tectonic. ... The dynamic of the change of the crust thickness in the orogens in 20 m.y. time in obtained, which corresponds to the real collision time. ... FRACTAL ANALYSIS AND SEARCHING FOR DETERMINISM IN EEG DATA. ... Our analysis show that time series of seismic energy have fractal properties in a range more than one order on frequency. ...

Еще в разделе: (Показать все результаты (>23) - dynamo.geol.msu.ru/ )

... Advanced chapters of operation research . Algebraic characterization of basic solution of linear program. ... Advanced chapters of Actuarial Mathematics . ... Discounted cash flow analysis and capital budgeting as decision tools are given particular emphasis. ... In the first part of the course we present a modern approach to modeling economic systems. ... The problem of tax optimization under a given financing budget. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>15) - hcs.cmc.msu.ru/ )

• Master program "Information Security and Cryptography" | Магистерское и

COMPARISON OF CLUSTERING ALGORITHMS FOR SPEAKER IDENTIFICATION Nikolay Lubimov, Evgeny Mikheev, Alexey Lukin Moscow Lomonosov State University, Moscow, Russia In this paper we consider the problem of text-independent speaker identification that refers to acoustic recognition research. ... We have performed the comparison of different clustering methods for speaker identification: the standard K-means clustering, K-means++, Linde-Buzo-Gray, Fuzzy C-means, and Gustafson-Kessel algorithms. ...

Еще в разделе: (Показать все результаты (>81) - imaging.cmc.msu.ru/ )

• Ringing effect modeling | Laboratory of Mathematical Methods of Image...

Home People Activities Research Publications . Yurin's home page . ... Юрин Д.В. "Расчетно-параметрическое исследование флуктуаций сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // Автореферат диссертации на соискание ученой степени кандидата физико-математических наук (специальность 01.04.03-радиофизика). ... Юрин Д.В. "Метод расчета статистических характеристик сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // В кн. ...

Еще в разделе: (Показать все результаты (>5) - imaging.cs.msu.ru/ )

Моделирование процессов утилизации муниципальных отходов. ... Представлено описание пяти видов математических моделей, позволяющих оценить влияние различных факторов на эффективность проведения процессов утилизации муниципальных отходов. ... Даны рекомендации по применению различных математических моделей для расчетов возможности и эффективности утилизации муниципальных отходов с учетом различных факторов. ... городская среда, математическое моделирование, утилизация отходов . ...

Еще в разделе: (Показать все результаты (>29) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=30&from=&ref_ind=1105004095
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=5&subtheme=22&from=&ref_ind=0301000451
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=28&from=&ref_ind=0210000232

... Senior Lecturer, Chair of General Physics, Physical Department, Moscow State University; Ph.D. Igor I. Vlasov . Senior Researcher, Center of Research in Natural Sciences, Institute of General Physics of RAS; Ph.D. Igor G. Persiantsev . ... The Nesmeyanov Institute of Organoelement Compounds of Russian Academy of Sciences. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>22) - rswater.phys.msu.ru/ )

JOURNAL OF APPLIED PHYSICS 100, 033718 2006 Transition between N- and Z-shaped current -voltage characteristics in semiconductor multiple- quantum - well structures O. V. Pupyshevaa Institute for Materials Research, Tohoku University, Sendai 980-8577, Japan and Department of Low Temperature ... -8577, Japan Received 17 January 2006; accepted 17 June 2006; published online 14 August 2006 We study theoretically the vertical electron transport in semiconductor multiple- ... Phys. Lett. ...

Еще в разделе: (Показать все результаты (>16) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/Masyukov-Dmitriev-11-JAP-InN.pdf

... 2006, . ... 424-436 Rybakov A. A. at al -- MCE -- 2006, v. 2, p. 424-436 , , . ... Mathematical Models In Biology, Ecology And Chemistry ek ( e k *e j = k j ) (1). ek ( ), . ... Phys. --1989. Vol. ... Amitrano C., Berry R.S. Probability distributions of local Liapunov exponents for small clusters // Phys. Rev. Lett. ... Chaotic behavior of triatomic clusters // Phys. Rev. A. -- 1997. ... Yurtsever E. Angular-momentum-driven chaos in small clusters // Phys. Rev. A. -- 1998. ...

Еще в разделе: (Показать все результаты (>21) - beams.chem.msu.ru/ )

• http://beams.chem.msu.ru/doc/JAP2004_96_109.pdf
• http://beams.chem.msu.ru/doc/Dynamical_systems_Theory_and_applications.pdf
• http://beams.chem.msu.ru/sotrudniki/larin/IJQC70.pdf

Institute of Mechanics , . Lomonosov Moscow State University , . ... Phone: +7 495 939 2039 . Fax: +7 495 939 0165 . E-mail: mailybaev imec.msu.ru . ... Mathematics . stability theory and dynamical systems . ... Physics and Mechanical Engineering . ... Engineering Faculty, University of l'Aquila, Italy . ... Department of Engineering Mechanics, Dalian University of Technology, China . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>28) - mailybaev.imec.msu.ru/ )

, JavaScript : ..-.. .. : .., .., .., Samsung Research & Development Institute, Russia W orld W ide W eb JavaScript, W eb-. Web-, («Internet of Things») Web- , JavaScript , . , . JavaScript . 17.00 18.30 507. 10 2014. , , : jsseminar@outlook.com

Еще в разделе: (Показать все результаты (>2) - master.cmc.msu.ru/ )

... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...

Еще в разделе: (Показать все результаты (>2) - angel.cmc.msu.ru/ )

... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...

Еще в разделе: (Показать все результаты (>2) - sa.cs.msu.ru/ )

... E. Anderson, Z. Bai, C. Bischof, J. Demmel, J. Dongarra, J. Du Croz, A. Greenbaum, S. Hammarling, A. Mckenney, S. Ostrouchov, and D. Sorensen, LAPACK Users' Guide, Society for Industrial and Applied Mathematics, Philadelphia, PA, second ed., 1995. ... E. Anderson, Z. Bai, C. Bischof, J. Demmel, J. Dongarra, J. Du Croz, A. Greenbaum, S. Hammarling, A. Mckenney, and D. Sorensen, LAPACK: A portable linear algebra library for high - performance computers, Computer Science Dept. ...

Еще в разделе: (Показать все результаты (>36) - num-anal.srcc.msu.ru/ )

• БЧА НИВЦ МГУ. SF55R. Специальные функции математической статистики
• БЧА НИВЦ МГУ. SF55R_P. Специальные функции математической статистики

... Paradigm shifts by Kuhn: successive change of one model by another, rather than integration of different paradigms Progress of science: from single- to multi-model approach Some examples from natural science... · theory of light: from vibration of ether to wave-particle duality · laws of motion: from Newton's dynamics to SchrЖdinger 's and Heisenberg's formalism In social and environmental sciences appreciation of the multi-model ...

Еще в разделе: (Показать все результаты (>6) - oc.cs.msu.ru/ )

• CURRICULUM VITAE

J/AstL/vol/page SAI Open Clusters Catalog (Glushkova+, 2009) ================================================================================ Automated search for star clusters in large multiband surveys. ... Color excesses E(B-V), distance moduli and ages were determined for 141 new and 27 known, but poorly studied clusters. We present the Sternberg Astronomical Institute Open Clusters Catalog (SAI OCL Catalog) of coordinates, diameters and main physical parameters of these clusters. ...

Еще в разделе: (Показать все результаты (>185) - ocl.sai.msu.ru/ )

• SAI Open Star Clusters (SAI OCL) Catalog

V.S. Chernysh, A.A. Haidarov, V.S. Kulikauskas. ... V.C. Chernysh, W. Eckstein, A.A. Haidarov, V.S. Kulikauskas, V.A. Kurnaev, E.S. Mashkova, V.A. Molchanov. ... В.С. Куликаускас, Е.С. Машкова, В.А. Молчанов, А.А. Хайдаров, В.С. Черныш, В. Экштайн. ... Поверхность, 1999, ?4. ... V.C. Chernysh, W. Eckstein, A.A. Haidarov, V.S. Kulikauskas, E.S. Mashkova, V.A. Molchanov. ... V.S. Kulikauskas, E.S. Mashkova, V.A. Molchanov, A.A. Haidarov V.S. Chernysh and W. Eckstein. ... Поверхность. ...

Еще в разделе: (Показать все результаты (>4) - physelec.phys.msu.ru/ )

Development of new approaches to the analysis of ring shapes in organic molecules and the description of electronic distribution (atomic charges) and halogen bonding in the framework of forcefield model for rapid estimation of intra- and intermolecular interaction energies in molecular mechanics, molecular dynamics and docking methods . Forcefield is a model and a set of parameters for theoretical description of intra- and intermolecular interactions. ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>3) - qsar.chem.msu.ru/ )