Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... K -correction in choose filter.. ... Redshift . Colour choose colour.. Colour value . Calculator . ... calculate spectral energy distributions , K-corrections calculator , GALEX FUV NUV , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...

Еще в разделе: (Показать все результаты (>3) - kcor.sai.msu.ru/ )

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Outreach . ... TEPA?2012 was held at Lomonosov Moscow State University, Russia. ... Workshop on ?Lomonosov? project held in Moscow State University, November, 28-30, 2011 . ... Current state of the project as a whole. ... Space vehicle status. ... Universitetsly-Tatiana-2?, and the space project ?Chibis?, being developed by Space Research Institute of RAS (IKI RAS) in collaboration with Moscow State University. ...

Еще в разделе: (Показать все результаты (>6) - lomonosov.sinp.msu.ru/ )

• Mikhail Lomonosov ? the Pioneer of Russian Science | Университетский спутник

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>2) - math.phys.msu.ru/ )

Home Bulletins . ... The Workshop continues a series of workshops started by the Skobeltsyn Institute of Nuclear Physics of Lomonosov Moscow State University in 1985 and conceived with the purpose of presenting topics of current interest and providing a stimulating environment for scientific discussions on new developments in theoretical and experimental high energy physics and physical programs for future colliders. ... Advisory Committee . ... J. Ellis (CERN, Geneva) . ... R. Heuer (CERN, Geneva) . ...

Еще в разделе: (Показать все результаты (>42) - qfthep.sinp.msu.ru/ )

• INFORMATION BULLETIN No.2
• Bulletins'2010
• INFORMATION BULLETIN No.1

... Data . ... Meteor-3M . ... Overview ] [ Proton fluxes ] [ Electron fluxes ] . Meteor-3M is a satellite manufactured by Joint Stock Company "Research and Production Corporation Space Monitoring Systems, Information and Control and Electromechanical Complexes" named after A.G. Iosifian" ("VNIIEM Corporation" JSC) Moscow, Russia. ... Meteor-3M is a joint Russian-US environment/atmosphere monitoring meteorological satellite. ... Spacecraft latitude [degrees] . ... Electrons 0.115 KeV . ...

Еще в разделе: (Показать все результаты (>6) - smdc.sinp.msu.ru/ )

• Space monitoring data center INTERHELIOS PROJECT

Annu. ... Key Words stellar energy production, Nobel Prize, supernova, binary pairs s Abstract Astrophysics has been an important part of my personal and scientific life three times. ... Gamov suggested to one of his graduate students, Charles Critchfield, that he actually calculate the proton-proton reaction. ... In stars, the proton-proton reaction is usually followed by a chain of reactions with the end result of producing 4He. ... In 1938, they suggested energy production in stars. ...

Еще в разделе: (Показать все результаты (>64) - astro.uni-altai.ru/ )

... However, derivation of its main equations from the free energy of a superconductor was only briefly described in the original paper [3], and some basic points of this procedure are still not completely understood. ... What is the sense of the free energy variation with respect to the vector potential of the magnetic field? ... Indeed, in practical calculations the Ginzburg­Landau equations are often used in combination with the Ginzburg­Landau free energy of the superconductor. ...

Еще в разделе: (Показать все результаты (>5) - lizard.phys.msu.su/ )

ARM . 12: · ARM 2 ARM Powered Products 3 ARM · 4 · ARM 32- . ARM : ­ Byte - 8 bits ­ Halfword - 16 bits ( ) ­ Word - 32 bits ( ) · ARM ­ 32-bit ARM Instruction Set ­ 16-bit Thumb Instruction Set 5 · ARM : ­ User : , ­ FIQ : , high priority (fast) ­ IRQ : , low priority (normal) ­ Supervisor : Software Interrupt instruction ­ Abort : ­ Undef : ­ System : , 6 User ARM Current Visible Registers Abo Und rtMod SVCMode IRQ ef Mode FIQ Mode e User ...

Еще в разделе: (Показать все результаты (>3) - lvk.cs.msu.su/ )

... About Us . ... Symbols of the Faculty . ... Students . ... The English Language Department for Science Faculties . ... The English Language Department for Science Faculties has been part of the Faculty of Foreign Languages and Area Studies since I988 when the latter was established. ... However, professional interests of many members of the Department extend far beyond teaching English to science students the teachers also support other projects of the Faculty of Foreign Languages and Area Studies. ...

Еще в разделе: (Показать все результаты (>25) - ffl.msu.ru/ )

• Наш факультет
• Научная жизнь

... Linguistic expeditions . ... Logical and stylistic aspects of lexical semantics . ... Linguistic phenomena can be approached and described from various perspectives. ... The approach proposed here is distinctive in that it is based on logic and stylistics, which are usually considered marginal to the description of linguistic phenomena. ... A special focus in the present approach on parallel texts is directly connected with translation . ...

Еще в разделе: (Показать все результаты (>2) - lcl.srcc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

112. http://higeom.math.msu.su/people/taras/mypapers/keldysh100en.pdf

113. Parallel Programming

114. http://hpc.msu.ru/files/hpcmsu/downloads/MSU_CCOE.pdf

115. http://scan.sai.msu.ru/omc_converter/

116. http://antares.sinp.msu.ru/docs/INFN%20-%20NEMO.pdf

117. Персональные страницы

118. http://cryst.geol.msu.ru/en/

119. Animals | depozitariy