... MOIP (Moscow Society of Naturalists) is a unique social phenomenon in Russia?s life. ... Great scientists and thinkers such as academicians V.I. Vernadskiy and N.D. Zelinskiy presumed that MOIP acted in Moscow as the Academy of Sciences up to the Saint-Petersburg (Russian) Academy moving to the capital in the thirties of 20 th century. In the course of all these years, the Moscow Society of Naturalists united and coordinates almost all scientific potencies in the sphere of natural science. ...

Еще в разделе: (Показать все результаты (>21) - www.moip.msu.ru/ )

... The 2008 has continued the process of setting up the innovative nature of higher education and its dynamic development. ... Nowadays, country's Higher School faces several questions - what is the essence of new schools: secondary, Higher, additional and professional ones; what are society's future requirements; how retain Higher School traditions during country's innovative development; what forms of education could ensure professional training of youth? ... Happy New Year! ...

Еще в разделе: (Показать все результаты (>88) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/173.doc
• http://www.rsr-online.ru/doc/norm/111.doc
• About The Russian Union of Rectors

Converters . A converter from ASCI GRD (Surfer, Golden Software Inc.) files into IPI data format. A converter from Res2dInv and IRIS SysCal files (Windows) . ... Runtime Error 200 - 'Divide by 0' on fast PCs. ... The cause of this error is a bug of Borland Pascal 7 . Now we found the way to solve this problem (on page "Fix for Borland Pascal" ). ... 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics, Bobachev Alexei . ...

Еще в разделе: (Показать все результаты (>145) - www.geol.msu.ru/ )

• Near-surface electrical prospecting laboratory at Moscow University
• Faculty of Geology >> Departments
• Faculty of Geology >> Geology at Moscow State University

Converters . A converter from ASCI GRD (Surfer, Golden Software Inc.) files into IPI data format. A converter from Res2dInv and IRIS SysCal files (Windows) . ... Runtime Error 200 - 'Divide by 0' on fast PCs. ... The cause of this error is a bug of Borland Pascal 7 . Now we found the way to solve this problem (on page "Fix for Borland Pascal" ). ... 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics, Bobachev Alexei . ...

Еще в разделе: (Показать все результаты (>93) - geophys.geol.msu.ru/ )

• Near-surface electrical prospecting laboratory at Moscow University
• Page 2
• Geophysical department at Moscow University

Euro-Asian Astronomical Society . Old Welcome Page. Universitetskij prospect 13, 119899 Moscow, Russia. e-mail: boch@astronomy.msk.su , fax: +7-(095)-932-88-44, telex: 411483 MGU SU . ... Dr. Nikolai G. Bochkarev , Co-chairman of Euro-Asian Astronomical Society. New Welcome Page . General information about EAAS: in Russian (under construction), . ... Institute avenue 15, 142432 Chernogolovka, Moscow region, Russia. e-mail: gavrilov@issp.ac.ru , fax: +7-(096-57)-64-111 . ...

Еще в разделе: (Показать все результаты (>33) - www.issp.ac.ru/ )

• Institutes of Chernogolovka
• High Education in ISSP PAS, Chernogolovka
• International Science Olympiads

Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...

Еще в разделе: (Показать все результаты (>2) - oc.cs.msu.su/ )

... Paris 1941. ... Meyendorff J. La signification de la Rйforme dans l'histoire du christianisme // Meyendorff J. Orthodoxie et catholicitй. ... Qu'est-ce que l'Europe? ... Inhaltliche Perspektiven und massenmediale Darstellung, in: Quandt S.(ed.), Luther, die Reformation und de Deutschen. ... Religiцser und gesellschaftlicher Wandel in Deutschland zwischen 1555 und 1620 // Historische Zeitschrift, 246 (1988), 1-45 Reinhard W. Gegenreformation als Modernisierung? ... Die Katholische...

Еще в разделе: (Показать все результаты (>515) - hist.msu.ru/ )

• Department of Ancient History
• IV Russian
• Moscow University through Revolution and the Soviet Period

Laboratory of Ferroelectricity . Scientific cooperation . ... Cooperation . ... The laboratory collaborates with the following institutes and universities:: . Waseda Univesity (Tokio, Japan) . Hokkaido University (Sapporo, Japan) . Wroclaw Thechnic University (Wroclaw, Poland) . Institute of Crystallography (Moscow, Russia) . Ioffe Physico-Technical Institute (S.-Petersburg, Russia) . Physics Institute of Russian Academy of Sciences (Moscow, Russia) . ...

Еще в разделе: (Показать все результаты (>31) - ferro.phys.msu.ru/ )

• Department of General Physics and magneto-ordered matter. Physics Faculty of
• Physics Department of Moscow State University

... For 1st and 2nd-year students . Introduction to quantum physics . ... Contacts . ... 2003 2016 Department of Quantum Electronics . ... Еmployee * - Select - Fadeev Victor Fedyanin Andrey Kulik Sergei Panov Vladimir Penin Aleksandr Maslova Natalya Murzina Tatyana Nikulin Aleksandr Kitaeva Galiya Burikov Sergey Ezhov Alexander Muzychenko Dmitriy Oreshkin Andrey Prudkovskii Pavel Savinov Sergey Dolgova Tatyana Kuznetsov Kirill Lyubin Evgeny Maidykovsky Anton Shirshin Evgeny Straupe Stanislav . ...

Еще в разделе: (Показать все результаты (>30) - quantum.phys.msu.ru/ )

• Ezhov Alexander | Department of Quantum Electronics
• Dolgova Tatyana | Department of Quantum Electronics
• Dolenko Tatyana | Department of Quantum Electronics

. English . Русский . Navigation . Home . About . News . People . Research . Publications . Teaching . Contacts . Wiki . Webmail . Webmail (archive) . Your name * . Your e-mail address * . To mikhalkov . Subject * . Message * . Search . Username * . Password * . Create new account . Request new password .

Еще в разделе: (Показать все результаты (>164) - nanolab.phys.msu.ru/ )

• Contact chetvertukhin | Laboratory of Nanophotonics & Metamaterials
• Contact musorin | Laboratory of Nanophotonics & Metamaterials
• Contact khokhlova | Laboratory of Nanophotonics & Metamaterials

.

Еще в разделе: (Показать все результаты (>236) - nuclphys.sinp.msu.ru/ )

• Student of the Moscow Institute of Engineers of Railway Transport. 1945
• Ядерная физика в интернете
• A.M.Baldin

... E-mail: Tchytannya@gmail.com Website of the Conference: www.tchytannya.org.ua Mailing address: National University "Law Academy of Ukraine named after Yaroslav Mudriy", Department of the Constitutional Law of Ukraine, organizing committee of The International Science Conference of Young Scientists, Researchers, Postgraduates and Students "Values of modern constitutionalism (V Todyka's readings)" Pushkinska street, 77, Kharkiv, 61024, Ukraine. ...

Еще в разделе: (Показать все результаты (>14) - www.law.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• StructAlign feedback

... Social-Economic Geography of Foreign Countries . ... Department of Social-Economic Geography of Foreign Countries . ... Dr. Aleksey S. Naumov The Department was founded in 1934 by Moscow University professors Nikolay N. Baransky and Ivan A. Vitver as the Chair of Economic Geography of Capitalist Countries at the Faculty of geography and soil sciences. ... 1948-1959 Department of Economic Geography of Foreign Countries, . ... Social and Economic Geography of Foreign Countries: Textbook. Moscow. ...

Еще в разделе: (Показать все результаты (>110) - eng.geogr.msu.ru/ )

• Department of Meteorology and Climatology
• Sergey A. Sokratov
• Complex Mapping

contacts ]] . CompHEP . ... Members of CompHEP Collaboration: . SINP MSU, Moscow, Russia: E.Boos, V.Bunichev, M.Dubinin , L.Dudko, V.Edneral , V.ILyin, A.Kryukov , V.Savrin . ... Post address: CompHEP Collaboration Skobeltsyn Institute of Nuclear Physics Moscow State University 119991, Moscow RUSSIA Phone: +7(095)939-2875 Fax: +7(095)939-0397 E-mail: comphep@theory.sinp.msu.ru . Copyright (C) 2003-2006 CompHEP Collaboration Design by A.Kryukov . ... Contact us . ... CompHEP-3.3 Manual . ...

Еще в разделе: (Показать все результаты (>32) - comphep.sinp.msu.ru/ )

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>12) - belyakov.imec.msu.ru/ )

INTERNATIONAL CONFERENCE . February 26 - March 05, 2006, Moscow, Russia . ... Moscow State University . Institute of Mechanics of MSU . ... It follows the tradition of biannual confer-ences organized by the Institute of Mechanics of Moscow State University between 1976 and 2004 (see http://hit2003.narod.ru/ ), which were widely attended by scientists and students from the former Soviet Union. ... Phone, E-mail and Fax. ... Institute of Mechanics, Moscow State University . ...

Еще в разделе: (Показать все результаты (>39) - hit-conf.imec.msu.ru/ )

• Nonlinear Problems of Gydrodynamic Stability Theory
• Untitled

Doctor of Historical Sciences, professor . ... In 1985-2005 and from 2010 to present - fellow of the Institute of Russian history of Russian Academy of Sciences. Executive editor of the journal "Medieval Russia" (in 1996). Laureate of the prize named after V. O. Klyuchevsky of the Russian Academy of Sciences in 2006 (for the book "Russia: From the Slavic Settlement to the Moscow Kingdom"). ... Author of about 200 works on Russian history of the middle Ages and early modern times. ...

Еще в разделе: (Показать все результаты (>22) - www.hist.msu.ru/ )

• Moscow State University. Faculty of History. Visiting Scholar's Program

... Processes of regionalization in Post-Soviet space: contradictions of Russia-Belarus Integration. Moscow, Institute of economy RAS, 2010. ... Eurasian Economic Integration. ­ 2010, 1. 4. 10 years of EurAsEC: everything is just starting (in co-authorship with R. Grinberg)./ ... Scientific Reports of the Institute of Economics of RAS. ... Analytical Bulletin of the Centre for Problems of Globalization and Integration of Institute of economics of Russian Academy of Sciences", 2007, Issue 4 (12). ...

Еще в разделе: (Показать все результаты (>31) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/images/Intriligator_trnslt.pdf
• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf

Moscow, 17-21 June 2013 . ... Conference email address: vmb70@higeom.math.msu.su . ... Victor Enolskii (Kiev, Ukraine) . ... Ivan Panin (St. Petersburg, Russia) . ... Iskander Taimanov (Novosibirsk, Russia) . ... Ivan Arzhantsev (Moscow, Russia) . ... Elena Bunkova (Moscow, Russia) . ... Nikolay Dolbilin (Moscow, Russia) . ... Nickolay Erochovets (Moscow, Russia) . ... Dmitry Gugnin (Moscow, Russia) . ... Andrei Kustarev (Moscow, Russia) . ... Stefan Nemirovsky (Moscow, Russia) . ...

Еще в разделе: (Показать все результаты (>213) - higeom.math.msu.su/ )

• Alexey Garber
• Alexey Garber (Russian)
• Conferences (English)