Home Search Collections Journals About Contact us My IOPscience The role of scattering on atomic nucleus and of electron state entanglement in single ionization of He by ion impact This article has been downloaded from IOPscience. ... In inelastic scattering, due to the orthogonality of one-electron states, the transitions of different electrons are summed in the amplitude with all other electrons non-active. ... Chem. 45 125. where fppf is the ordinary amplitude of elastic scattering. ...
[
Текст
]
Ссылки http://danp.sinp.msu.ru/LIIWM/JPhys_ConfSer194_8_082007_VAKho.pdf -- 412.7 Кб -- 08.02.2011 Похожие документы
... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...
... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...
... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...
Transhumus : Integrated software solution for interpretation of FT-ICR mass spectra of natural organic matter Anton Grigoryev1, 2, Alexey Kononikhin 1 2 2, 3 , Irina Perminova4, Eugene Nikolaev2, 3 ansgri@gmail.com Institute for Energy Problems of Chemical Physics, Moscow , Russia 3 Institute of Biochemical Physics, Moscow , Russia 4 Lomonosov Moscow State University, Moscow , Russia Natural organic matter ( ... However, there still are problems with interpretation of mass spectra of NOM. ...
[
Текст
]
Ссылки http://www.mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf -- 315.1 Кб -- 26.11.2010
[
Текст
]
Ссылки http://mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf -- 315.1 Кб -- 26.11.2010 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
XXVIII General Assembly of the IAU, SPS15 Beijing, August 31, 2012 . N.N. Samus, S.V. Antipin "Variable Stars and Data-Intensive Astronomy" . During the 26th IAU General Assembly in Prague, the IAU Division V (Commissions 27 and 42) considered the future of variable-star catalogues. ... To discuss these problems and to look for their solutions, the IAU Commission 27, on behalf of the IAU Division V, created an informal working group, chaired by the GCVS editor, Dr. Nikolai Samus. ...
THE THIRD ANNUAL STUDENTS' SCIENTIFIC CONFERENCE ON TODAY'S TOPICAL POLITICAL AND PHILOSOPHICAL ISSUES Panel of philosophy ALEXANDER BOURGANOV AND HIS `NEW ROMANTICISM' CONCEPTION Liyamina Anastasiya Faculty of philosophy 1st year student Alexander N. Bourganov occupies an important place among famous masters of modern sculpture. ... He tries to find philosophical foundation for mathematics. ... Existential dread is examined by Kierkegaard in his work "The concept of anxiety". ...
[
Текст
]
Ссылки http://www.ffl.msu.ru/future-students/lingua-4-teens/tezis-filosof.pdf -- 86.4 Кб -- 24.03.2014
[
Текст
]
Ссылки http://ffl.msu.ru/future-students/lingua-4-teens/tezis-filosof.pdf -- 86.4 Кб -- 24.03.2014 Похожие документы
Summary Progress Report 2010 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf -- 1926.1 Кб -- 13.09.2014 Похожие документы
О кафедре . ... Наглядная и компью терная геометрия и топология . ... Г.В.Носовский. ... Математические заметки, т. 33, вып. 2, 1985, с. 325-333. ... Об условиях, возникающих при оценке производных решений стохастических дифференциальных уравнений в римановых пространствах.. ... Тезисы Бакинской международной конференции по топологии и ее приложениям. ... В.В.Калашников, Г.В.Носовский, А.Т.Фоменко. ... Г.В.Носовский, А.Т.Фоменко. ... Вып. ... А.А.Голованов, Д.П.Ильютко, Г.В.Носовский, А.Т.Фоменко. ...
... 12, 43 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...
О кафедре . ... Динамические задачи теории упругости . Динамика пластин и оболочек . ... Методы теории упругости . ... Нелинейная теория упругости . ... Пластины и оболочки . ... Теория и расчет оболочек тонкостенных летательных аппаратов . ... Теория упругости структурно-неоднородных тел . ... Уравнения изгиба пластин классическая линейная теория. ... Колебания пластин. ... Oscillation of plates . ... МГУ им. М.В.Ломоносова, механико-математический факультет, кафедра теории упругости . ...
... Заведующий лаборатории - профессор А.В. Немухин . ... IV Международный симпозиум "Topical Problems of Biophotonics", 21-27 июля , Нижний Новгород Приглашенный доклад: М.Г. Хренова , А.В. Немухин, А.П. Савицкий "Molecular modeling of the Forster resonance energy transfer between fluorescent proteins" . ... Конференция Biocatalysis-2013, 2-7 июля Москва Доклад: А.В. Немухин "Molecular mechanisms of the enzymatic hydrolysis reactions of nucleotide triphosphates" . ...
Magnetism Department MSU . ... Research groups . ... Students . Phd students . ... The basics of spintronics. prof . Vedyaev ю. Actual problems in modern magnetism . prof . Granovsky A. The physical basics of magnetism . associate prof . Kotel'nikova O. Magnetic phase transitions. associate prof . Kotel'nikova O. Physics of magnetic phenomena. associate prof . Kotel'nikova O. Introduction in group theory and its application in physics of magnetic phenomena. associate ...
... Master . ... Participants . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Gnedin Yu.N. Investigation of vacuum polarization in strong magnetic fields of neutron stars: Zel'dovich ideological impetus . ... Doroshkevich A.G. Beyond the limits of the LambdaCDM cosmology . ... Illarionov A.F. Title is discussed . ... Imshennik V.S. Title is discussed . ... Polnarev A.G. Polarization of CMB generated by Cosmological Gravitational Waves . ... Ruzmaikin A.A. A game of chance . ...
The final deadline for pre-registration and abstract submission is 20 May 2002. ... Workshop Proceedings are available for download. 30 Sep 2002 . Information on Workshop Proceedings . 28 Aug 2002 . Venue of the Workshop . 12 Jul 2002 . Workshop program is available now! ... 24 May 2002 . Visas to Russia? ... Information on accomodation in Petropavlovsk. New topic "1952 Kamchatka tsunami" was added. ... Information . ... Tel: 7(095) 939-3698 Fax: 7(095) 124-8713 . ...
... 2 Telescop e finder Do not rely on that the nominal alignment of coordinate system Auto Alignment made on stars will serve a long time. ... The Meade telesc tages: 1) there is no possibility to common error in the telescope soft system, when telescope moving in ope parking using command :hP# has the following disadvanobtain information on the completion of this procedure, 2) a often leads to tripping-over a limiter and to loss of coordinate a horizontal coordinate system. ... Home Position. ...
... hall in front of room 01, MSU, Main Building . ... room 01, MSU, Main Building . ... Silvia Chelala (Empire State College, State University of New York, Old Westbury, New York, USA) Designing and Teaching Introductory Spanish as a Foreign Language at a Distance . ... FFL, recreation hall, 3rd floor . ... FFL, room 519 . ... FFL, room 501 . ... FFL, . room 107-108 . ... Internet-Supported Teaching . ... FFL, room 106 . ... FFL, room 416 . ... FFL, room 420 . ... FFL, room 210 . ...
... Expanding and Retaining Customer Loyalty with Stefan Legner of InterNetX . Legner started with a brief history of InterNetX, a Regensburg, Germany based hosting and domain registrar provider that has more than 19,500 customers worldwide.He emphasized the need for companies to build long term partnerships, adding that business has always been about the relationship between people rather than companies .Where possible, Legner said that companies should provide an ... cheap the north face . ...