THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... New approaches to the synthesis of colloidal quantum dots on InP based biomarkers to create . ... For this it is necessary to carry out the replacement of stabilizing shells . ... To replace the membranes using standard samples CT InP, MA stabilized , since the latter is quite labile ligand , as well as samples of heterostructures InP / ZnSe with two monolayers Accrued zinc selenide and also stabilized myristic acid. ...

Еще в разделе: (Показать все результаты (>35) - www.lssm.inorg.chem.msu.ru/ )

... Преподаватель ВШБ Сергей Заверский выступил с докладом 'Spatial Distribution of Government Authorities and Regional Development' на 12-й ежегодной международной конференции Aleksanteri Conference в Хельсинки, Финляндия. Тема конференции этого года - 'Competition and Good Society - The Eastern Model' . ...

Еще в разделе: (Показать все результаты (>86) - www.mgubs.ru/ )

. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001

Еще в разделе: (Показать все результаты (>19) - www.rochesterastronomy.org/ )

. Fig. 1. A - Absorption spectrum of phytoplankton suspension from central area of the Baltic Sea. Values of absorption coefficients are averaged over spectral regions 400-550 nm (afl) and 400-700 nm (a S ). B - Spectrum of the light used to excite chlorophyll fluorescence in PrimProd fluorometer (1), and spectral distribution of underwater illumination in clear water at depths of 1 (2), 5 (3), and 20 m (4). Fig. 2. Histograms of km (A) and I 1/2 m (B) distribution, obtained at the stations of Baltic S ea.

Еще в разделе: (Показать все результаты (>15) - www.biophys.msu.ru/ )

• http://www.biophys.msu.ru/primprod/Figures/Fig_r2.htm
• http://www.biophys.msu.ru/primprod/Figures/Fig_r4.htm
• http://www.biophys.msu.ru/primprod/Figures/Fig_r6.htm

International Symposium Quasifission Process in Heavy Ion Reactions Messina (Italy) November 8-9, 2010 First Circular Chairman : Giorgio Giardina ( Messina ) Co-Chairman: Avazbek Nasirov (Dubna) Co-Chairman: Sara Pirrone (Catania) Scientific Secretary: Giuseppe Mandaglio ( Messina ), and Alessia Di Pietro (Catania) Local Organizing Committee: Giovanni Fazio ( Messina ), Giorgio Giardina ( Messina ), Giuseppe Mandaglio ( Messina ), Marina Manganaro ( ...

Еще в разделе: (Показать все результаты (>163) - phys.msu.ru/ )

• Title

3D Simulation of Stress - strain State in Pneumatic Tires. ... Moscow State University, Russia . Section 1.1 . ... Mechanical model for computation of Stress - strain State in pneumatic tires. ... Numerical simulation of axisymmetrical Stress - strain State in tires. ... Axisymmetrical Stress - strain State in tire. ... Numerical simulation of 3D Stress - strain State in tires . ... Solution of contact problem on tire contacting rigid surface in view of friction on contact surface. ...

Еще в разделе: (Показать все результаты (>4) - composite.msu.ru/ )

• Department of the Composites Mechanics
• INTAS 95-525 Final Reprort (Short version)

Symbolic circuit-matrix processor and evaluator . ... This software is reliable over the range of benchmark circuit complexity (both *.CIR and *.MAT file). ... SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... pure ASCII text . ... CIRSYM - SYMbolic CIRcuit processor used to format ASCII text file *.out for CALCSYM. ...

Еще в разделе: (Показать все результаты (>6) - astrometric.sai.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Briedis V. Pareto Structures A great Italian economist Vilfredo Pareto (1848 ґ 1923) in his unique economics and sociology studies [1, 2] continuously emphasised the systematic approach, reviewing the society development problems. ... Formal model of Pareto Structure First of all, provide a formal mathematical model adequately featuring the Pareto Structure. ... Indeed, I was primarily interested in the classical (harmonic structure) model at s = 1. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf

.

Еще в разделе: (Показать все результаты (>4) - lab110.imec.msu.ru/ )

... Parent Directory - _vti_cnf/ 24-Oct-2012 02:50 - filelist.xml 08-Dec-2003 16:18 476 image001.gif 08-Dec-2003 16:18 5.3K image002.wmz 08-Dec-2003 16:18 427 image003.gif 08-Dec-2003 16:18 393 image004.wmz 08-Dec-2003 16:18 469 image005.gif 08-Dec-2003 16:18 537 image006.wmz 08-Dec-2003 16:18 374 image007.gif 08-Dec-2003 16:18 245 image008.wmz 08-Dec-2003 16:18 454 image009.gif 08-Dec-2003 16:18 521 image010.wmz 08-Dec-2003 16:18 391 image011.gif 08-Dec-2003 16:18 338 . ...

Еще в разделе: (Показать все результаты (>41) - genphys.phys.msu.su/ )

• Index of /rus/edu/kvant/II_2/STAT2/_private/distribution.files/_vti_cnf
• Микромаг - сервер

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>30) - mailybaev.imec.msu.ru/ )

. Название публикации . Nuclear Magnetic Resonance Spectroscopy in Solving the Analytical Problems of Medicine: Analysis of Cerebrospinal Fluid . Авторы . T.N. Kolokolova, O.Yu. Savel'ev, N.M. Sergeev, O.A. Shpigun, K.V. Sokolov, V.I. Skvortsova . Дата . 31.12.2009 23:00:00 . Название журнала . Journal of Analytical Chemistry. Том . Vol.65 . Номер . 10. первая страница . 1073 . последняя страница . 1081. Купить нет на складе . 2009 ФФМ МГУ, 2009

Еще в разделе: (Показать все результаты (>9) - fbm.msu.ru/ )

... Студенческая Астрономическая обсерватория ГАИШ . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... For those really interested in galaxies, extragalactic astronomy or the aspects of cosmology we study, we can always find an interesting problem to work on. ... To make your work in the Group most effective, it would be useful to study the following courses read by our group members as well as the members of other groups in our and other institures. ... Student information . ...

Еще в разделе: (Показать все результаты (>22) - www.sai.msu.ru/ )

Backlinks to FAQDownloadSources in all Webs ( Search System Web only ) . ... Foswiki is distributed under the GNU General Public License, see FAQDownloadSources. GPL is one of the free software licenses that protects the copyright holder, and .. ... Number of topics: 1 . ... Copyright by the contributing authors. All material on this site is the property of the contributing authors. Ideas, requests, problems regarding Foswiki? ...

Еще в разделе: (Показать все результаты (>23262) - wiki.cs.msu.ru/ )

• (backlinks in System Web) FAQDownloadSources < System < Foswiki
• (backlinks in System Web) TipsOfTheDayAdmin < System < Foswiki
• (backlinks in all Webs) TipsOfTheDayAdmin < System < Foswiki

Nuclear Instruments and Methods in Physics Research B 235 (2005) 448ґ451 www.elsevier.com/locate/nimb Reflection of nitrogen ions from copper surface: Experiment and calculations N.V. Novikov, Ya.A. Teplova *, Yu.A. Fainberg, V.S. Kulikauskas Institute of Nuclear Physics, Moscow State University, 119899 Moscow, Russia Available online 29 April 2005 Abstract The angular and energy distributions of nitrogen ions reflected from the Cu-surface are measured at the incident energy 300 keV. ...

Еще в разделе: (Показать все результаты (>114) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/pci2014/vesher1_27.pdf
• http://danp.sinp.msu.ru/LIIWM/PhysRevA73_06_062712Kabach_Kazanski.pdf
• http://danp.sinp.msu.ru/LAS/Nimb256_07_21Teplova.pdf

... Dr. G. Koptsik . ... Aim of this project is to develop a tool to quantify the risks of excess inputs of heavy metals to agricultural and forest ecosystems. ... Geographically the accent will be put on agricultural and forest ecosystems of the Northern (Kola Peninsula) and Central (Upper Oka-river basin) parts of Russia. ... Koptsik G.N., Nalbandyan K.F. 2002. ... Koptsik, S., Koptsik, G., and Eruslankina, L. Heavy metals in subarctic forest ecosystems: soil pollution and impacts on plant diversity. ...

Еще в разделе: (Показать все результаты (>27) - eco.soil.msu.ru/ )

• Koptsik G.N., et al. Soils of the National Park "Russian North".
• Norwegian-Russian cooperation in the border area
• CLEANSOIL, An innovate method for the on-site remediation of polluted soil

... 10, 63 ґ 64 (2010) / DOI 10.1002/pamm.201010024 Integrability and nonintegrability in terms of transcendental functions in dynamics of a rigid body Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., ... This circumstance allowed the author to perform a complete analysis of all phase trajectories and highlight those properties of them which exhibit the roughness and preserve for systems of a more general form. c 2010 Wiley-VCH Verlag GmbH & Co. ...

Еще в разделе: (Показать все результаты (>45) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-136-1.pdf
• http://shamolin2.imec.msu.ru/art-133-1.pdf
• http://shamolin2.imec.msu.ru/art-134-1.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

... Virtual work . ... A piecewise polynomial defined on this partition is a polynomial of low degree on each element . ... Partitioning a matrix in rows and columns . ... Matrix partitioning . Matrix partition . ... Partition of the matrix into blocks . Partitioning the matrix into blocks . ... Column partition of a (the) matrix . Column partitioning of a (the) matrix . ... Row partition of a (the) matrix . Row partitioning of a (the) matrix . ... Разложение в . ... Arcsine distribution . ...

Еще в разделе: (Показать все результаты (>99) - num-anal.srcc.msu.ru/ )

• http://num-anal.srcc.msu.su/eng_math/redict/1.htm
• http://num-anal.srcc.msu.su/list_wrk/ps1/ch3st4.ps
• http://num-anal.srcc.msu.su/eng_math/redict/8.htm

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ґ velocity potential, H ґ depth, ґ vector of bottom deformation, 0 ґ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>15) - ocean.phys.msu.ru/ )