... Plants . ... The study of structural and functional plant systems diversity at different levels (cell-to-biocenotic) will reduce the risk of violating the stability of the living systems in Russian Federation. Russian Federation plays a key role in the preservation and use of raw Arctic potential. The highest spore plants, as an essential component of plant communities in northern Holarctic are involved in the settlement of naked substrates, preservation of permafrost and bogging. ...

Еще в разделе: (Показать все результаты (>15) - depository.msu.ru/ )

• Biological information | depozitariy

Russian . Selected publications of V. Zakharov 2015 . Zakharov V.S., Perchuk A.L., Zavyalov S.P., Sineva T.A., Gerya T.V. Supercomputer Simulation of Continental Collisions in Precambrian: The Effect of Lithosphere Thickness // Moscow University Geology Bulletin. ... P. 77?83. doi: 10.3103/S014587521502012X. Paper (pdf) . ... Paper (pdf) . ... Summary in English . ... DOI: 10.3103/S014587521101011X. Paper (pdf) . ... Paper (pdf) Summary in English . ... Page design: ?V.Zakharov . ...

Еще в разделе: (Показать все результаты (>33) - dynamo.geol.msu.ru/ )

• Summaries of articles

HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММ?И ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, © м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...

Еще в разделе: (Показать все результаты (>41) - cryst.geol.msu.ru/ )

. Up: new_24_4 Previous: Литература . This document was generated using the LaTeX 2 HTML translator Version 2K.1beta (1.48) . Copyright © 1993, 1994, 1995, 1996, Nikos Drakos , Computer Based Learning Unit, University of Leeds. Copyright © 1997, 1998, 1999, Ross Moore , Mathematics Department, Macquarie University, Sydney. The command line arguments were: . latex2html new_24_4.ltx . The translation was initiated by Dmitriy Bizyaev on 2001-09-07 . Dmitriy Bizyaev 2001-09-07

Еще в разделе: (Показать все результаты (>169) - comet.sai.msu.ru/ )

• Installing UNIXhelp locally
• Other mail programs
• Models recipes

... T. A. Dolenko, S. A. Burikov, K. A. Laptinskiy, and O. E. Sarmanova, Improvement of the fidelity of molecular DNA computations: control of DNA duplex melting using Raman spectroscopy, Laser Physics, v. 26, No 2 Jessica M. Rosenholm, Igor I. Vlasov, Sergey A. Burikov, Tatiana A. Dolenko, and Olga A. Shenderova. ... A.O. Efitorov, S.A. Burikov, T.A. Dolenko, I.G. Persiantsev, S.A. Dolenko. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>44) - rswater.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

... What's new . ... The new version of the General Catalogue of Variable Stars (GCVS4.2) revised taking into account the new data accumulated since the 4th GCVS edition for the constellations: Canis Minor, Capricornus The new version of the GCVS ! ... The new version of the General Catalogue of Variable Stars (GCVS4.2) revised taking into account the new data accumulated since the 4th GCVS edition for the constellations: Apus, Cancer, Canes Venatici and Canis Major The new version of the GCVS ! ...

Еще в разделе: (Показать все результаты (>136) - sai.msu.ru/ )

• GCVS Research Group: Recent publications
• Презентация PowerPoint

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . ... Links . ... CDFE => Links . ... Space Physics Online Data Services at MSU SINP . Japan Atomic Energy Research Institute Nuclear Data Center . Korean Atomic Energy Research Institute Nuclear Data Center . MacNuclide Nuclear Data Base Management System . ... Radiation Safety Information Computational Center , Oak Ridge National Laboratory . ... Los Alamos National Laboratory Nuclear Data Viewer . ...

Еще в разделе: (Показать все результаты (>48) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page
• CDFE => Publications
• CDFE => Online Services => Dynamic atomic nuclei deformation animation

... Частичная проблема собственных значений . ... Частично . ... Partially immersed body . ... Частичное отображение . ... Doppler frequency shift . ... Number of specimens in the population . Число закрутки (потока) . ... A base two (ten) number . ... The Reynolds number based on the relative velocity between the droplet and the gas . ... Чисто геометрический характер . Purely geometric nature . ... The condition number of a matrix is a measure of sensitivity to perturbations of its elements . ...

Еще в разделе: (Показать все результаты (>207) - num-anal.srcc.msu.ru/ )

• БЧА НИВЦ МГУ. ZF30R_C. Решение системы уравнений общего вида
• БЧА НИВЦ МГУ. ZF30R_P. Решение системы уравнений общего вида

Backlinks to WebLeftBarCookbook in System Web ( Search all webs ) . ... NEW - 26 Aug 2011 - 18:18 by ProjectContributor . ... NEW - 02 Sep 2010 - 17:49 by ProjectContributor . ... NEW - 18 Mar 2011 - 19:48 by ProjectContributor . ... Copyright by the contributing authors. All material on this site is the property of the contributing authors. Ideas, requests, problems regarding Foswiki? ...

Еще в разделе: (Показать все результаты (>1725) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) WebLeftBarCookbook < System < Foswiki
• UserDocumentationCategory < System < Foswiki
• (backlinks in all Webs) FamFamFamFlagIcons < System < Foswiki

... Первая десятка | ... Первая десятка "Русского переплета" Темы дня: . ... This document was generated using the LaTeX 2 HTML translator Version 96.1 (Feb 5, 1996) Copyright © 1993, 1994, 1995, 1996, Nikos Drakos , Computer Based Learning Unit, University of Leeds. ... The translation was initiated by Lipunov V.M. on Tue Sep 23 14:45:21 MSD 1997 . Lipunov V.M. Tue Sep 23 14:45:21 MSD 1997 . ...

Еще в разделе: (Показать все результаты (>170) - www.pereplet.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . ... Senior IFP Fall 2005 . The Center on Philanthropy and Civil Society's Senior International Fellows Program provides an opportunity for the professional development of Third-Sector practitioners from outside the United States who are decision makers in their professions. The program is designed to help build Third-Sector capacity in the Fellows' home countries. ... The topic for the year 2005 will be community foundations . ...

Еще в разделе: (Показать все результаты (>578) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Конференция "Вакансии"
• Клуб выпускников МГУ: Варданян Рубен Карленович

... Phys., 6, 313, 1955); his study also was base on the magnetometers data. The first instant auroral ring model based on experimental all-sky camera data was presented by Olga Khorosheva in 1961. ... But it was Olga who reconstructed first continuous auroral image and firmly defended the auroral ring model. ... Имя Ольги Хорошевой не было известно за рубежом, она не участвовала в международных конференциях, и модель "колечка Хорошевой" не получила широкого распространения. ...

Еще в разделе: (Показать все результаты (>249) - www.kosmofizika.ru/ )

• CREATION AND DESTRUCTION OF THE SOLAR PROTON BELTS IN THE INNER MAGNETOSPHERE
• CRRES 560
• L.Lazutin, List of publications

... About Journal | ... The Editorial team's publication decisions are made based on the data reliability and the scientific value of the work despite the race, gender, nationality, citizenship, social position, religious or political views of the Authors. ... The Reviewer performs the impartial expertise of Author's materials. ... The Reviewer must notify the editorial team on any interest conflict with the Author, with the request for excluding him from the reviewing of the given manuscript. ...

Еще в разделе: (Показать все результаты (>50) - www.socio.msu.ru/ )

• English version - Социологический факультет МГУ

... Design of small molecule antiviral compounds against tick-borne encephalitis, dengue fever, and other diseases caused by flaviviruses . ... K. N. Sedenkova, E. V. Dueva, E. B. Averina, Y. K. Grishin, D. I. Osolodkin, L. I. Kozlovskaya, V. A. Palyulin, E. N. Savelyev, B. S. Orlinson, I. A. Novakov, G. M. Butov, T. S. Kuznetsova, G. G. Karganova, N. S. Zefirov. Synthesis and Assessment of 4-Aminotetrahydroquinazoline Derivatives as Tick-Borne Encephalitis Virus Reproduction Inhibitors . ...

Еще в разделе: (Показать все результаты (>18) - qsar.chem.msu.ru/ )

• Cytokinin Receptors - Laboratory of Medicinal Chemistry
• Molecular switches - Laboratory of Medicinal Chemistry

... Полная версия этой страницы: Работа в Samsung . Студенческий форум Физфака МГУ > Общий > Работа . ... Telecommunication Network . ... Job Summary: The Optical Engineer will be involved in the design, fabrication and testing of optical/digital imaging system for mobile devices. ... Required Skills: Must have proven optical design and algorithm skills, lens design experience using code-V or equivalent lens design software. ... Company: Samsung Electronics Telecommunication Network Business . ...

Еще в разделе: (Показать все результаты (>591) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > MSc/PhD positions in the Optical Sensors for
• Студенческий форум Физфака МГУ > [NEW!] Аспирантура во Франции
• Студенческий форум Физфака МГУ > Casimir vacuum energy and the semiclassical

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... BDRG . ... DEPRON . ELFIN-L . ... The satellite ?Mikhailo Lomonosov? is based on the platform of the spacecraft ?Kanopus-B? developed by the All-Russia reasearch and development institute of electromechanics named after Iosiphyan (VNIIEM). ... Scientific equipment will weight about 120 kg, while the total weight of the satellite will be about 450 kg. ...

Еще в разделе: (Показать все результаты (>59) - lomonosov.sinp.msu.ru/ )

• Mikhail Lomonosov ? the Pioneer of Russian Science | Университетский спутник
• DEPRON | Университетский спутник "Ломоносов"
• IMISS-1 | Университетский спутник "Ломоносов"

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>2) - www.edst.msu.ru/ )

... Moscow State University . ... Research . ... Lecturer, School of Physics, . ... vladimir.lobaskin@ucd.ie . Vladimir Lobaskin obtained a First Class Honours Degree in Solid State Physics (1989) from Chelyabinsk State University (CSU) and a Ph.D. (1993) from the Urals State Technical University (UPI). He took then a lecturer position in the Physics Department of Chelyabinsk State University. ... In 2008 he moved to the School of Physics at University College Dublin (UCD) . ...

Еще в разделе: (Показать все результаты (>61) - nanofluidics.phys.msu.ru/ )

• Olga I. Vinogradova
• Maduar
• Theses

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: ?аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>62) - ecfs.msu.ru/ )

• The world Bank's agriculture and rural development in the region Europe and
• Resources | ECFS
• Draft Plan of Action for Eurasian Subregional Partnership | ECFS