... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... https://cs.msu.ru/node/1707 . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>18) - ani.cmc.msu.ru/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the
• The ASR Department at the CMC Faculty of Lomonosov MSU
• Courses | Department of the Automation for Scientific Research CMC MSU

... Faculty of Physics . ... Research Centers . ... Second harmonic generation in metamaterials with magnetodipole resonance . ... In the research performed by collaboration of scientists from Laboratoire d'Optique Appliqu?e (France), Centro Ricerche Frascati (Italy), and Faculty of Physics of M.V. Lomonosov Moscow State University was for the first time made the detailed experimental study of completely isolated low-order harmonics obtained with interferential filtering from the wide harmonic spectrum....

Еще в разделе: (Показать все результаты (>185) - phys.msu.ru/ )

• Российско-сингапурский форум в МГУ
• Russian-Singapore forum at M.V.Lomonosov Moscow State University

... This course is dedicated to the main principles, methods and techniques of parallel programming oriented at resolution of resource-intensive tasks physically and in non-linear optics in particular. The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... Antonov, A.S. Parallel Programming Using MPI. ...

Еще в разделе: (Показать все результаты (>17) - engineering.phys.msu.ru/ )

PhD Summer School on Scentific Computing . ... Paula Carroll, University College, Dublin, Ireland . ... Irina Fedulova and Sergey Pevtsov, Moscow State University, Russia . ... John Houlihan, Waterford Institute of Technology, Ireland . ... Jimmy McGibney, Waterford Institute of Technology, Ireland . ... Micheal O hEigeartaigh, Waterford Institute of Technology, Ireland . ... Paul O'Kelly, Waterford Institute of Technology, Ireland . ... Michael Ryan, Waterford Institute of Technology, Ireland . ...

Еще в разделе: (Показать все результаты (>48) - angel.cs.msu.su/ )

• Index
• Generated Documentation (Untitled)
• Foreword

Service . Analytical Laboratory Provides Service In The Field Of . Applied Statistics. Training in applied statistics and in statistical software tools usage. Formalization of practical problems and solution algorithms choosing. Applied statistical problems solving, using Your data. ... Consultations on choosing of Russian and American software tools for applied statistical problems. Phone/Fax: (095) 939-5306 . e-mail: makarov@makarov.msu.ru . ... Fax . ... InCo . ...

Еще в разделе: (Показать все результаты (>3) - statsoft.msu.ru/ )

• InCo literature in English

University Satellites and . Space Science Education . ... A SERIES OF ATLASES ON METHODS OF SPACE IMAGES INTERPRETATION AS A NEW TOOL FOR REMOTE SENSING EDUCATION IN EARTH SCIENCES . ... Special manuals in the form of atlases of satellite images and their interpretation results are within the best tools for support of the geographical and ecological research and thematic mapping. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>60) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University

Go to main page.. ... Currently my research activities are under the supervision of prof. Potemkin I.I . ... Currently we are trying to estimate the stability limits of Janus structures in solutions of mixture of diblock copolymers (see picture below). ... 1) 4th year report (pdf, 363 KB, in Russian) . 2) Presentation 4th year (Microsoft PowerPoint, 1212 KB, in Russian) . 3) First presentation 5th year (pdf, 673 KB, in Russian) . 4) Second presentation 5th year (ppt, 634 KB, in Russian) . ...

Еще в разделе: (Показать все результаты (>210) - polly.phys.msu.ru/ )

• PSMTLab - Polyelectrolytes
• Practicums - Chair of Polymer and Crystal Physics
• Scientific Work

... Virtual work . ... A piecewise polynomial defined on this partition is a polynomial of low degree on each element . ... Partitioning a matrix in rows and columns . ... Matrix partitioning . Matrix partition . ... Partition of the matrix into blocks . Partitioning the matrix into blocks . ... Column partition of a (the) matrix . Column partitioning of a (the) matrix . ... Row partition of a (the) matrix . Row partitioning of a (the) matrix . ... Разложение в . ... Arcsine distribution . ...

Еще в разделе: (Показать все результаты (>811) - num-anal.srcc.msu.ru/ )

• Параллельные программы. ЛИТЕРАТУРА

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

. Название публикации . Nuclear Magnetic Resonance Spectroscopy in Solving the Analytical Problems of Medicine: Analysis of Cerebrospinal Fluid . Авторы . T.N. Kolokolova, O.Yu. Savel'ev, N.M. Sergeev, O.A. Shpigun, K.V. Sokolov, V.I. Skvortsova . Дата . 31.12.2009 23:00:00 . Название журнала . Journal of Analytical Chemistry. Том . Vol.65 . Номер . 10. первая страница . 1073 . последняя страница . 1081. Купить нет на складе . 2009 ФФМ МГУ, 2009

Еще в разделе: (Показать все результаты (>10) - fbm.msu.ru/ )

... Species distribution . ... Sequence conservation . ... According to Pfam database there have been found 7134 HTH3 gene sequences in 975 various species. Most of the these sequences were found in different bacteria, though they were also found in viruses and phages, archaea and eukaryotes. Among bacteria (totally 666 species) HTH3 genes are widely distributed and present in Bacterioidetes (12 species), Cyanobacteria (20), Actinobacteria (73), Proteobacteria (353), Firmicutes (164) and others. ...

Еще в разделе: (Показать все результаты (>339) - monkey.belozersky.msu.ru/ )

• ETS species distribution

PTOLEMY'S FAILINGS . ... The Crime of Claudius Ptolemy. ... Almost as a stocktaking of Ptolemy , the 1970s saw the publication of three monographic writings on his astronomy , viz, O. Neugebauer's authoritative account of the contents of the Almagest in its context of the mathematical side of the rest of ancient astronomy , 1 O. Pedersen's Almagest companion volume designed to guide also the student of Latin astronomy up to the Renaissance, 2 and R. R. Newton's ...

Еще в разделе: (Показать все результаты (>96) - hbar.phys.msu.ru/ )

• Ответ Wally на книгу "Крах С14"
• Age Determinations by Radiocarbon Content: Checks with Samples of Known Age

О лаборатории . ... Лаборатория теоретической биофизики . Published in Февраль 8th, 2016 . Posted by comcon1 in Без рубрики . ... ERG group members work with different types of molecules and consequently added new atomtypes into classical OPLS-AA distributed with GROMACS. Now the ERG patch of OPLS-AA force field is published at bitbucket as a repository. continue reading.. ... Published in Май 19th, 2015 . ... comcon1 in All-atom automatic OPLS-AA topology? . ... 2014 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>43) - erg.biophys.msu.ru/ )

• Peter Mamonov ERG Research Group: Лаборатория теоретической биофизики
• Reaction-diffusion systems in 2D space with python ERG Research Group:
• topology ERG Research Group: Лаборатория теоретической биофизики

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ HYDROACOUSTIC ANTENNA : A POWERFUL TOOL TO FORECAST TSUNAMIGENIC EARTHQUAKES Yakov S. Karlik Central Research Institute MORPHYSPRIBOR , 46 Chkalovsky proezd, Sankt-Petersburg, 197378 Russia E-mail: karlik@mail.cl.spb.ru ABSTRACT Hydroacoustic antenna ... 2001). ... Eiby, J.A., 1982: Earthquakes. ...

Еще в разделе: (Показать все результаты (>26) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E15_Nosov_Kolesov.pdf
• http://seac47-2.phys.msu.ru/proc/Recommendations.pdf
• http://seac47-2.phys.msu.ru/proc/E01_Armigliato.pdf

Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...

Еще в разделе: (Показать все результаты (>6) - www.fbm.msu.ru/ )

... Distribution of neutron counting rate near the Earth surface is studied in two directions - to the Earth and from it - according experimental data, obtained in Moscow in 1996. ... We suppose that logarithmically normal distribution describes an input of the Earth crust into the neutron flux. ... Usual periods . ... Full approximation of thermal neutrons distribution near the Earth crust is presented as a sum of two functions - Poison distribution and logarithmically normal distribution. ...

Еще в разделе: (Показать все результаты (>108) - www.kosmofizika.ru/ )

. 21.04.2014-23.04.2014 . Вход . Enter .

118. http://srd.sinp.msu.ru/nymmik/models/hilgers.pdf

119. http://danp.sinp.msu.ru/LIIWM/ArXiv-0904.2151v1_Khodyrev2009.pdf

120. Koptsik G.N., et al. Soils of the National Park "Russian North".