General Information . ... Symposium expenses . ... Presentation information . ... Travel information . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... From metro station "Belorusskaya" (green line) travel to metro station "Teatral'naya" (green line). ... From metro station "Paveletskaya" (green line) travel to metro station "Teatral'naya" (green line). ... After that make a change to "Biblioteka imeni Lenina" (red line) and travel on to metro station 'Universitet' (red line). ...

Еще в разделе: (Показать все результаты (>15) - ged.chem.msu.ru/ )

.. , . . , . .. (e-mail: galami7@mail.ru) , , " ", , creative class, informational workers, social inequality, "Homines Aeris", netocracy , . . , . In article different options of conceptualization of a creative class are considered, its characterologic signs are allocated. Attempt of definition of its place in social structure of modern societies is made. Those social effects which are connected with formation of a creative class are analyzed.

Еще в разделе: (Показать все результаты (>48) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2013/4/09.pdf
• http://www.socio.msu.ru/vestnik/archive/2011/3/01.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/2/05.pdf

... I would like to invite you to visit my website http://www.againstchance.webs.com/ where I present the demonstration of my invention, the device for predicting the Future. It is a computer program which reveals the reaction of the computer to the future creation of a file, and since the command to create a file can be given to the computer in accordance with the outcome of any external event, such a reaction can predict that event, too. ...

Еще в разделе: (Показать все результаты (>19) - temporology.bio.msu.ru/ )

ARM . 12: · ARM 2 ARM Powered Products 3 ARM · 4 · ARM 32- . ARM : ­ Byte - 8 bits ­ Halfword - 16 bits ( ) ­ Word - 32 bits ( ) · ARM ­ 32-bit ARM Instruction Set ­ 16-bit Thumb Instruction Set 5 · ARM : ­ User : , ­ FIQ : , high priority (fast) ­ IRQ : , low priority (normal) ­ Supervisor : Software Interrupt instruction ­ Abort : ­ Undef : ­ System : , 6 User ARM Current Visible Registers Abo Und rtMod SVCMode IRQ ef Mode FIQ Mode e User ...

Еще в разделе: (Показать все результаты (>9) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/lecture1_formal_methods.pdf

... Professors: Corresponding member of RAS S.A.Dobrolubov (water masses, ocean and atmosphere interaction), corresponding member of RAS S.K.Gulev (ocean and atmosphere interaction), academician of RAS A.S.Sarkisian (sea currents theory); . ... Data bases have been created: for Caspian Sea hydrological and hydrochemical observations in the second half of the XX century involving more than 70 thousands of oceanologic stations; for Black Sea about 60 thousands stations with thermohaline observations. ...

Еще в разделе: (Показать все результаты (>47) - eng.geogr.msu.ru/ )

• Available cartographic data
• Recreational Geography and Tourism
• Department of Land Hydrology

Russian version . ... Leninskie Gory 1, Moscow, 119991, Russia . ... The title is: "The development of resonant X-ray reflectivity method near the L2,3 absorption edges for investigations of magnetic multilayers". ... Moscow. ... Russia. ... A. Smekhova, е.ю. Gan'shina, B.S. Roschin, A.D. Gribova, M.A. Andreeva, F. Wilhelm, A. Rogalev, "Structural and Magnetic Studies of [Co 0.45 Fe 0.45 Zr 0.1 /a-Si] N Multilayers", Journal of Spintronics and Magnetic Nanomaterials, 1 (1), pp.11-17 (2012) [pdf] . ...

Еще в разделе: (Показать все результаты (>18) - magn.phys.msu.ru/ )

• Сотрудники кафедры магнетизма: Ведяев Анатолий Владимирович

The Program: Moscow State University’s Faculty of History invites applications from scholars, graduate students and undergraduates wishing to spend a sabbatical semester or year abroad conducting academic research in the history of Russia, the Soviet Union, and the Soviet successor states. All visiting scholars and students will have the unique opportunity to participate in the rich intellectual life of the Faculty of History’s community, partaking in its activities. ... Moscow State University . ...

Еще в разделе: (Показать все результаты (>4348) - www.hist.msu.ru/ )

• Publications
• ЭОС истфака МГУ: Кафедра исторической информатики
• The Laboratory of Historical Information Sciences

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Reports on progress and error are always recorded in the log file of the program. ... UT date of the measurement finish in YYYY-MM-DD format UT time of the measurement finish in hh:mm:ss format Average flux in A aperture Average flux in B aperture Average flux in C aperture Average flux in D aperture Normalized variance of flux in A aperture Normalized variance of flux in B aperture Normalized variance of flux in C aperture Normalized variance of flux in D ...

Еще в разделе: (Показать все результаты (>23) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/dimm_soft_description.pdf
• http://curl.sai.msu.ru/mass/download/doc/sv_ug.pdf

Software Protection: How to Crack Programs, and Defend Against Cracking" In the first part of this course we will learn how to "crack" programs, i.e.how hackers break into software to extract secrets, remove license checks, etc. ... Learning about this type of computer security is important because many current systems are vulnerable to cracking attacks. ... The course will have practical homework exercises where you will crack small programs, and use tools to protect against cracking. ...

Еще в разделе: (Показать все результаты (>2) - master.cmc.msu.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . Эта конференция предназначена для общения выпускников МГУ проживающих и работающих в США. Добавить сообщение . ... Автор: Irina Orlova . Дата: 09.07.2007 20:36 . ... Anna Cobb forwarded your message to me suggesting that I should try and get in touch with you. ... Hello Anna, . ... Автор: Anna Kuznetsova . ... Автор: Anna Cobb . ... Anna . ... Автор: Anna Cpbb . ... Выпускник Географического ф-та МГУ 1993 года Сычев Олег. ...

Еще в разделе: (Показать все результаты (>472) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Конференция "Вакансии"
• Клуб выпускников МГУ: КИБЕРНЕТИЧЕСКАЯ ЛИЧНОСТЬ. БЕССМЕРТИЕ?

An electronic file with the submitted manuscript should be of the following form. %---------------------------- \def\udk{UDC} \ltitle{Title of the manuscript (in CAPITAL LETTERS)} {Author initials and name(s)} \oabstract{ Abstract of the manuscript } Text of the manuscript \end{document} %-------------------------- . ... Sectioning of a manuscript without the use of standard commands can be done as follows: %------------------------------------------------ \par {\bf Title of the section.} ...

Еще в разделе: (Показать все результаты (>75) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник

... Here is a brief outline of the current theory of the events in the early history of the solar system: . A cloud of interstellar gas and/or dust (the "solar nebula") is disturbed and collapses under its own gravity. ... The gas cools off enough for the metal, rock and (far enough from the forming star) ice to condense out into tiny particles. (i.e. some of the gas turns back into dust). ... Once the larger of these particles get big enough to have a nontrivial gravity, their growth accelerates. ...

Еще в разделе: (Показать все результаты (>2) - www.iki.rssi.ru/ )

... Forums . ... for Food Security . ... International Forumљon Eurasian Food Security and Nutrition Network and Eurasian Soil Partnershipљ will present the opportunity to discuss and analyze current trends in food security management in the Eurasian region; generate the discussion about best and most effective practices to promote and expand multi- and cross-sectoral collaboration on a country, regional and global level; and offer the floor for the Eurasian Soil Partnership Plenary meeting. ... Forum ....

Еще в разделе: (Показать все результаты (>27) - ecfs.msu.ru/ )

• The structure of the ECFS | ECFS
• About Eurasian Center for Food Security | ECFS