Software Protection: How to Crack Programs, and Defend Against Cracking" In the first part of this course we will learn how to "crack" programs, i.e.how hackers break into software to extract secrets, remove license checks, etc. ... Learning about this type of computer security is important because many current systems are vulnerable to cracking attacks. ... The course will have practical homework exercises where you will crack small programs, and use tools to protect against cracking. ...

Еще в разделе: (Показать все результаты (>2) - master.cmc.msu.ru/ )

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>110) - eng.geogr.msu.ru/ )

• THE MAKKAVEEV LABORATORY OF SOIL EROSION AND FLUVIAL PROCESSES
• Recreational Geography and Tourism
• ICCE events

... Conference registration and abstract submission deadline is May 12, 2007. ... The registration fee for foreign participants is 250 USD. This includes book of abstracts, bus transfer from Moscow airport to Dubna and back, hotel reservation, social program. The accommodation and meal are at the expense of participants. The registration fee for Russian participants fee is 800 Rubles. This includes book of abstracts, postage expenses, hotel reservation and rental of premises. ...

Еще в разделе: (Показать все результаты (>101) - www.msm.biophys.msu.ru/ )

• MSM 2007
• Transport and Maps

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>213) - www.genebee.msu.ru/ )

• Fasta 3.4
• GeneBee service
• GeneBee Basic BLAST 2.0

sin, cos, log [1 , N] c 1 . ... for-, , , sizeof. /* beg, beg+step,...,beg+step*(N-1) */ #include <stdio.h> #include <math.h> /* . define N 5 /* , N =10 */ struct Func { char* name; /* double (*fp)( double ); /* } func [] = { { sin , sin { cos , cos { log , log { NULL, NULL }; */ */ }, }, }, } int main() { int beg = 1, /* - step = 1, /* end = beg + (N-1)* step , /* - numfuncs = sizeof( func )/sizeof(struct Func ) - 1; /* func int i; ... sin | ... cos | ...

Еще в разделе: (Показать все результаты (>6) - al.cmc.msu.ru/ )

... A This result can be applied to a wide variety of data sets, including electricity bills1, street addresses, lengths of rivers, physical and mathematical constants, and processes described by power laws. ... Based on the plausible4 assumption that people who make up figures tend to distribute5 their digits fairly uniformly, a simple comparison of first-digit frequency distribution from the data with the expected distribution according to Benford's law had to show up any anomalous results. ...

Еще в разделе: (Показать все результаты (>20) - www.eng.math.msu.su/ )

... Nonlinear Phenomena in Bubbly Liquids . ... In particular in a result of experimental studies of intensity dynamics of laser beam scattering the idea about two-phase state of real liq-uids was formulated. Using the conservation laws of gas dynamics and assumption that nonline-arity of processes is mainly determined by the bubble dynamics the two-phase mathematical model for average pressure and volumetric concentration of gas phase was suggested. ...

Еще в разделе: (Показать все результаты (>245) - acs366.phys.msu.su/ )

• Abstract
• ISNA-16
• General Information

Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Moscow, 2008 Acknowledgements A.Belinskiy M.Kornilov A.Tokovinin M.Kuznetsov P.Kortunov E.Gorbovskoy SAI administration some SAI students Pulkovo solar station (KHSS) staff RFBR support MAVEG Gmbh Why to study optical turbulence and some other relevant ... Mean seeing by DIMM data for this night is 1''5. ...

Еще в разделе: (Показать все результаты (>20) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/dimm_soft_description.pdf
• http://curl.sai.msu.ru/mass/download/doc/infrasoft_eng.pdf

... Выпускники . Выпускники ВМиК . ... Женский клуб . ... Издательство МГУ . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... Senior IFP Fall 2005 . The Center on Philanthropy and Civil Society's Senior International Fellows Program provides an opportunity for the professional development of Third-Sector practitioners from outside the United States who are decision makers in their professions. The program is designed to help build Third-Sector capacity in the Fellows' home countries. ...

Еще в разделе: (Показать все результаты (>458) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: International Fellows Program
• Клуб выпускников МГУ: Исследовательские стипендии и гранты в США и Канаде.
• Клуб выпускников МГУ: Конференция "Выпускники ВМиК"

Marketing Plan Outline Canada Business Service Centres - CBSCs Last Verified: 2004-11-08 Document No. 4014 Summary A marketing plan is designed to direct company activities towards the satisfaction of customer needs; determine what the customer wants, develop a product/service to meet those needs, get the product/service to the end user and communicate with the customer - at a profit! ... levels, sales volumes? ... What is the consumer acceptance price range for this type of product/service? ...

Еще в разделе: (Показать все результаты (>47) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

Summary of results and experience in Data Science Alexander P. Ryjov Associated Professor, Chair of Mathematical Foundations of Intelligent Systems, Department of Mechanics and Mathematics, Lomonosov Moscow State University, Professor and Head, Chair of Business Processes Management Systems, IT Business School, Russian Presidential Academy of National Economy and Public Administration. ... Systems for evaluation and monitoring of complex processes. ... Banks: credit scoring system. ...

Еще в разделе: (Показать все результаты (>115) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Science :: Conference :: 9th International Conference
• General Information

... Run program . User's guide . Launching program . Input data format . ... Selecting the number of correlated pairs . ... In order to run thr program one needs Java 5.0 environment. ... At the end of computations one will be asked to review the selected number of correlated pairs. ... Note: One may redefine the number of correlated pairs by selecting the 'Edit' -> 'redefine correlated pairs number' menu item. Correlated pairs of positions are presented as a colored matrix, the heatmap. ...

Еще в разделе: (Показать все результаты (>138) - bioinf.fbb.msu.ru/ )

• Input Formats
• SDPlight
• RNA Kinetics: Theory

... Vice-Dean, Physics Department, M.V.Lomonosov Moscow State University . Vice-Director, International Laser Center, M.V.Lomonosov Moscow State University . ... International Laser Center and Faculty of Physics . ... Radiophysics including Quantum Electronics . ... Victor Zadkov's current research interests are in the field of laser physics, interaction of laser radiation with matter, molecular dynamics of photoexcited molecules, coherent control, quantum optics and physics of quantum information. ...

Еще в разделе: (Показать все результаты (>77) - qilab.phys.msu.ru/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... The laboratory of chemistry and physics of sensor and semiconductor materials is the largest laboratory of Inorganic chemistry department , Lomonosov Moscow State University. The laboratory staff include 21 members and there are 25 students and postgraduate students of Chemistry Faculty , Physics Faculty and Faculty of Materials Science . ... semiconductor materials for sensors . ... Phone: +7(495) 939 54 71 . ...

Еще в разделе: (Показать все результаты (>21) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and

Department of Southern and Western Slavic History . ... Department Head: Professor G.F.Matveev. ... State Systems and State Institutions . Political Processes, Relations, Parties and Organizations; Political Thought . ... Traditional and Modern Cultures, Education, International Relations and the Place of the Slavic States in International Relations . Relations of Slavic Peoples with their Neighbors . Interslavic Relations . History of Slavic Studies . ...

Еще в разделе: (Показать все результаты (>183) - hist.msu.ru/ )

• Department of General Art History
• International Summer School 2011 "Russian History and modernity: the
• Labour recruiting policy and the Nobel Association of Oil Producers. A Set of

... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 27 марта 2016 года Московский государственный университет имени М.В.Ломоносова приглашает на весенний ДЕНЬ ОТКРЫТЫХ ДВЕРЕЙ . ... New technologies in gas chemistry . ...

Еще в разделе: (Показать все результаты (>5) - www.hsib.msu.ru/ )

• Master Degree in Geology | Высшая школа инновационного бизнеса МГУ

... Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. We have grown up in the laboratory of laser spectroscopy of water media. ... Use of such powerful modern tools of solution of inverse problems and problems of optimization provides successful solution of a wide range of applied problems of diagnostics and analysis of water media. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>25) - rswater.phys.msu.ru/ )

... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . Important dates . ... The beginning of the conference: June 17, 2008 . The closing of the conference: June 22, 2008 . ...

Еще в разделе: (Показать все результаты (>51) - pont2008.cmc.msu.ru/ )

• Registration International Conference Differential Equations and Topology
• On mathematical creative work of L.S. Pontryagin (By D.V. Anosov) International

... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...

Еще в разделе: (Показать все результаты (>15) - www.issp.ac.ru/ )

• Astronomy and Space Physics: Russian Federation Olympiad 1995/96