... A comparative study of thermodynamic for both natural and artificial RNA/DNA protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf -- 140.7 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/bioelectro2002.pdf -- 140.7 Кб -- 18.02.2008 Похожие документы
VIEWS Paul Murdin M T Wright Data, information and science I was one of almost half the IAU General Assembly that voted against the IAU resolution initiated by Elizabeth Griffin in Manchester in August 2000. ... The IUE archive, for example, delivers ultraviolet spectra into the hands of the community at the same rate that the satellite itself used to do, and papers frequently appear that are based on the archive. Other space missions like ISO and XMM have and are completing similar archives. ...
Joint Design of Micrometeoroid/Orbital Debris Impact Shield and Development of Failure Risk Assessment System for Orbital Spacecraft Nikolay G. Chechenin1, Peijie Li 1 2 Skobeltsyn Institute of Nuclear Physics Lomonosov Moscow State University 2Tsinghua University Space Debris Growth http://www.nasa.gov/pdf/582393main_OCT-Orbital_Debris_TAGGED.pdf January 26, 2016 2nd China-Russia Joint Space Science Project Proposals ...
[
Текст
]
Ссылки http://danp.sinp.msu.ru/Seminars_Pdf-filesPresentations/Chechenin_Presentation_14-01-16.pdf -- 1975.6 Кб -- 18.02.2016 Похожие документы
... This course is dedicated to the main principles, methods and techniques of parallel programming oriented at resolution of resource-intensive tasks physically and in non-linear optics in particular. The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... Antonov, A.S. Parallel Programming Using MPI. ...
The purpose of the space-physics lab exercises is to introduce the students to the methods of the measurements, to the modern conception of near-Earth space structure and the physical processes and phenomena occured in it. ... At present the reasearches and the teachers of the University and of other institutes participating in the project continue development of the the special space-physics lab exercises, and they are interested in your ideas concerning the future exercises. ...
... Положение об олимпиаде . ... Отборочный этап . ... от Оргкомитет олимпиады школьников "Ломоносов" - Четверг, 25 Февраль 2016, 12:10 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Среда, 3 Февраль 2016, 18:52 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Понедельник, 1 Февраль 2016, 17:12 . ... Оргкомитет олимпиады школьников ?Ломоносов? приглашает вас к сотрудничеству с целью организации и проведения заключительного этапа Олимпиады на вашей базе по различным профилям. ...
... Международные: . ... NICA-MPD . МЕЖДУНАРОДНЫЕ ПРОЕКТЫ. ... российский коллайдер протонов и тяжелых ионов, строящийся с 2013 года на базе Лаборатории физики высоких энергий (ЛФВЭ) им. В. И. Векслера и А. М. Балдина Объединенного института ядерных исследований (ОИЯИ), в городе Дубна Московской области. ... Ускорительный комплекс создается с целью исследования области физики частиц в ранее недоступной области параметров и условий эксперимента ? ...
The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...
. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
ft ra D DAYS on DIFFRACTION 2012 1 Theory of selfrefraction effect of intensive fo cused acoustical b eams V.A. Gusev Lomonosov's Moscow State University, Physical Faculty, Department of Acoustics, Russia, 119991, Moscow, Leninskie gori; e-mail: vgusev@bk.ru The theory of selfrefraction of nonlinear acoustical beams is developed based on some exact and approximate analytical equations and solutions. ... What is the main factor limiting the pressure in the focus -- diffraction or selfrefraction? ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gusev_files/diff2012.pdf -- 698.1 Кб -- 07.11.2012
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gusev_files/diff2012.pdf -- 698.1 Кб -- 07.11.2012 Похожие документы
COACHES . ... Kiseljev Dmitri . Head Coach . ... Lukyanchikov Dmitri . First Base coach, Power Lifting coach . ... Komissarov Dmitri . 3rd Base coach, Power Lifting coach . ... Erjemkin Alexey . ... Chichaev Ivan . ... Rich Reddrop* . ... Frolikov Alexey . ... Kudrjashov Alexander . ... Chichaev jr . ... Ned Reddrop* . ...
... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...
... Магистерское образование . ... Магистерские программы . ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Open Information systems? and ?Network software?. ... Are researched the most frequently used applied protocols of net security and protocol of creating virtual private nets. ... This is an obligatory course for 1-year students, studying for the magisterial degree ?Program devices of net?. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...
The subject of cybernetics is quickly growing and there now exists a vast amount of information on all aspects of this broad-based set of disciplines. ... The fields of application are virtually unlimited and applications are discovered in the investigation or modelling of any complex system. The most obvious applications have been in the construction of artificially intelligent systems, the brain and nervous system, and socio-economic systems. ...
FACULTAD DE CIENCIAS POLITICAS DE LA UNIVERSIDAD ESTATAL DE MOSCз M. V. LOMONсSOV Encargado del cargo de Decano - El doctor de ciencias historicas, Profesor (A. Yu. ... Al dia de hoy en la Facultad de Ciencias Politicas, funcionan cinco catedras: . ... La Facultad de Ciencias Politicas presta la posibilidad de realizar estudios especializados en los siguientes programas de estudio por contracto, los cuales han sido diseЯados con base a las necesidades del mercado laboral. ...
ARM . 12: · ARM 2 ARM Powered Products 3 ARM · 4 · ARM 32- . ARM : Byte - 8 bits Halfword - 16 bits ( ) Word - 32 bits ( ) · ARM 32-bit ARM Instruction Set 16-bit Thumb Instruction Set 5 · ARM : User : , FIQ : , high priority (fast) IRQ : , low priority (normal) Supervisor : Software Interrupt instruction Abort : Undef : System : , 6 User ARM Current Visible Registers Abo Und rtMod SVCMode IRQ ef Mode FIQ Mode e User ...