... Laboratory of Mathematical Methods of Image Processing . ... Congratulations to our alumni (bachelors) . ... Grid warping for image sharpening using one-dimensional approach (Andrey Krylov, Alexandra Nasonova, Andrey Nasonov) . ... Grid warping in total variation image enhancement methods (ICIP 2014, Andrey Nasonov, Andrey Krylov) . Image warping in dermatological image hair removal (ICIAR 2014, Alexandra Nasonova, Andrey Nasonov, Andrey Krylov, Ivan Pechenko, Alexey Umnov, Natalia Makhneva) . ...

Еще в разделе: (Показать все результаты (>545) - imaging.cmc.msu.ru/ )

• About Laboratory | Laboratory of Mathematical Methods of Image Processing
• View publication | Laboratory of Mathematical Methods of Image Processing
• Fast rank algorithms | Laboratory of Mathematical Methods of Image Processing

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Moscow State University Russian Language Centre . Moscow State University . ... Learn Russian at the Moscow State University! ... 28.05.2004 . New full on-line Russian language reference on our website! (more.. ... On April, 29, 2004 the rector of the Moscow M.V.Lomonosov State University academician V.A.Sadovnichy signed the order on creation of the Moscow school of economy of the Moscow M.V.Lomonosov State University. (more.. ... Space tourist calls Russian language his greatest challenge . ...

Еще в разделе: (Показать все результаты (>23) - www.rlcentre.com/ )

. Webcams . Networking . Weather . Power . System health . Measurements . Seeing at Sat Apr 9 22:26:00 2016 is Unknown . Copyright 2007 2013.

Еще в разделе: (Показать все результаты (>2) - eagle.sai.msu.ru/ )

... The common results (Ariel Yoshkar-Ola) will be published later · Pocherevin Roman (Lomonosov Moscow State University , Russia ) ­ 788 points · Tugova Ekaterina (Lomonosov Moscow State University , Russia ) ­ 788 points · Briukhova Natalia (Lomonosov Moscow State University , Russia ) ­ 742 points · Krasilnikov Aleksandr (Chelyabinsk State University , Russia ) ­ 645 I. Cuza University, Romania) ­ 253 points · Coman Florin-Alexandru (Al. ...

Еще в разделе: (Показать все результаты (>120) - new.math.msu.su/ )

• Osipenko Konstantin Yuryevich | Department: General Problems of Control.
• Scientific directions | Department: General Problems of Control. Faculty of
• Current staff list | Department: General Problems of Control. Faculty of

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>30) - dbserv.sinp.msu.ru/ )

• The Other BAFIZ Pages
• Riabina Online Data Set Selector
• BAFIZ at SINP MSU

... Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University, Moscow 119991, Russia. ... 6 C r o s s s e c tio n ( 1 0 In the present study the animated crossed electron -ion beams method [1] is applied for measurement of absolute cross sections for electron impact single and multiple ionization of C+, N+ and O+ ions at incident electron energy values up to 2.5 keV. 6 6 (a) C 2+ (b) N 2+ cm ) 2 - 17 4 4 2 2 0 10 6 100 1000 0 10 100 ...

Еще в разделе: (Показать все результаты (>11) - lmmqsp.sinp.msu.ru/ )

• Laboratory of Mathematical Models of Quantum Scattering Processes / MSU

To see a Russian version of this page, click here . ... Bochkarev Nikolai Gennadievich . astrophysics researcher: . born: Moscow, May 19, 1947; . ... Jr. researcher Sternberg Astronomical Inst., ... Soviet (Russian) Working Group on Interstellar Matter, Moscow , 1979-; . ... Madison, 1991. ... ALocal Interstellar Matter, 1990, . Basic Physics of the Interstellar Matter, 1992; co-author: . ... Physics of Interstellar Matter, 1979; . ... All-Union Astronom. Geodesical Soc., ... Astronom. ...

Еще в разделе: (Показать все результаты (>56) - uranus.sai.msu.ru/ )

• Anatol Cherepashchuk
• Irina Glushneva
• Igor Antokhin

A SEMI-CLASSICAL MODELING OF REVERSIBLE CHARGE SEPARATION IN REACTION CENTERS OF PHOTOSYNTHESIS. ... Charge separation is acco mpanied by oscillat ions o f a populat ion of RC states when RCs are excited by femtosecond (<30 fsec) light pulses. ... The simplest three states model P*BAHA P+BA­HA P+BAH does not provide the correct form o f the oscillat ions and does not explain the out-of-phase oscillat ions of the P* stimulated emissio n at 905 and 940 nm. ...

Еще в разделе: (Показать все результаты (>211) - mccmb.belozersky.msu.ru/ )

• MCCMB'11
• MCCMB'15
• MCCMB'13

The Chair of Mathematical Theory of Intelligent Systems and . ... Staff . ... Gasanov Elyar Eldarovich was born on November 14, 1959, in Moscow. ... In Moscow State University, E.E. Gasanov lectures the special courses "Theory of intelligent systems", "Theory of databases and information retrieval", "Additional chapters of discrete mathematics and mathematical cybernetics" and holds a special seminar in problems of complexity of search algorithms. ... Gasanov E.E. Instantly solvable search problems. ...

Еще в разделе: (Показать все результаты (>139) - www.intsys.msu.ru/ )

• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Science :: Conference
• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich

... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...

Еще в разделе: (Показать все результаты (>7) - discours.philol.msu.ru/ )

• Anna Kotomina
• Contact us

M obile A stronomical Sy stem of TE lescope- R obots MASTER-II Kislovodsk Lomonosov Moscow State University, Sternberg Astronomical Institute , Moscow Union "Optic" , Kislovodsk Solar Station Latitude = 43 o љ44'.767љN; Longitude = 42 o љ31'.417љE; Altitude = 2067љm MASTERљIIљ(8љsquareљdegress) + MASTERљVWF(VeryљWideљFieldљCameras (FOV=800 square degrees, Timeљresolutionљupљtoљ150љms, with unfiltered m_lim=14m on 5 sec. exposure, and ~10.5m with 0.15 sec) . ... 11h 38m 38.0s , -09d 59m 59s) . ...

113. ЛАБОРАТОРИЯ АВТОМАТИЗИРОВАННЫХ

114. Department of Mathematics, Faculty of Physics, Lomonosov MSU

115. Theses

116. Laboratory of Mechanics of Multiphase Media

117. International Congress of Russian Language researches - preliminary program

118. International School ?Computer simulation of advanced materials?, 16?21 July

119. http://www.elch.chem.msu.ru/~natasha/CV_Roznyatovskaya_pdf.pdf

120. Connection handling