Страница поддержки курса "Архитектура ЭВМ и язык ассемблера" для 1 потока . ... Ассемблер nasm . ... Программа курса . ... Компьютерные системы: архитектура и программирование. 1 издание . ... Итоги коллоквиума ?1 . ... Коллоквиум ?1 . ... Итоги экзамена и всего курса . ... Результаты коллоквиума ?1 . ... Older posts . Posted on 05.04.2016 by vartan . ... 5) Записать на языке ассемблера выражение с побочными эффектами, заданное на языке Си . ... Архитектура ЭВМ и язык ассемблера . ...

Еще в разделе: (Показать все результаты (>24) - asmcourse.cs.msu.ru/ )

• vartan | Архитектура ЭВМ и язык ассемблера
• Установка cygwin | Архитектура ЭВМ и язык ассемблера
• nasm @ linux | Архитектура ЭВМ и язык ассемблера

exhibition (16.03?25.04.05) | dates of life | ... exhibitions | ... gallery | ... russian . ... Metro "Kitay-gorod", Polytechnical Museum, entrance 2 . The works of Lidija Timoshenko are widely known to the specialists studying the Russian art of both pre- and post-WWII art. ... Most sheets from this series are being displayed in this exhibition, while the rest are kept in the Russian Museum, State Pushkin museum, Tretyakov Gallery, and other Russian museums. ...

Еще в разделе: (Показать все результаты (>12) - imk.msu.ru/ )

php /* * Backup script on server. ... Connects to the mySQL * database and creates a backup file of the whole database. ... Yes/No? ... It will void your warranty :-D! $ date = date ( mdy-hia ); $filename = $savepath/$dbname-$ date .sql ; if($use_gzip== yes ){ $ filename2 = $ file ; } else { $ filename2 = $savepath/$dbname-$ date .sql ; } if($send_email == yes ){ $fileatt_type = filetype($ filename2 ); $ fileatt_name = .$dbname. - .$ ... BR>"; $message .= "--{$mime_boundary}\n" ." ...

Еще в разделе: (Показать все результаты (>223) - observ.pereplet.ru/ )

• http://observ.pereplet.ru/images/GRB030416/
• http://observ.pereplet.ru/images/evgeny/stev/m_zams.php
• http://observ.pereplet.ru/images/evgeny/stev/m_phystab.php

Форум МГУ Главная Форум > общие > . ... Ответов Просмотров . ... LalBiassE , 4 сен 2012 . Ответов: . ... Просмотров: . ... LalBiassE . 4 сен 2012 . Fewepoxy , 4 сен 2012 . ... Fewepoxy . ... Bimmemituefly , 4 сен 2012 . ... looraPlult , 4 сен 2012 . ... teensecub , 4 сен 2012 . ... Критерий сортировки тем: Дата последнего сообщения в теме Дата создания темы Название темы (по алфавиту) Число ответов Число просмотров Число благодарностей за первое сообщение . ... Главная . Форум . ...

Еще в разделе: (Показать все результаты (>3) - osk.msu.ru/ )

... 1996. ... Contents . CONTENTS . ... Would Russia rise again? ... Alenaces to Russia's security . ... and the 'Helms - Burton' bill . ... and certain problems of the internal mission . Parlamentarism in Russia and abroad . ... of constitutionalism in Russia. ... Bills and legislative proposals. ... How to change the Constitution - on the . constitutive revision and amendements to the Constitution . ... Certain aspects of the federal bill on the minimum . ... in Oktober-November 1996 . ...

Еще в разделе: (Показать все результаты (>10) - www.niiss.ru/ )

... О МЛЦ МГУ . ... Абстракт: Basic quantum information measures involved in the information analysis of quantum systems are considered. It is shown that the main quantum information measurement methods depend on whether the corresponding quantum events are compatible or incompatible. For purely quantum channels, the coherent and compatible information measures, which are qualitatively different, can be distinguished. A general information scheme is proposed for a quantum-physical experiment. ...

Еще в разделе: (Показать все результаты (>69) - ilc.phys.msu.ru/ )

• Grant detail
• Грант подробно

This section of library contains information about "classic" Star Catalogs. ... For a Henry Draper Catalog 272149 stars have received a total of 531,211 identifications in 7 сatalogs: . 270456 - in Astrographic Catalogue ( "Carte du Ciel", 4M), . 251943 - in Guide Stars Catalog (GSC), . ... A file with information on the components of 1788 of multiple systems in catalog HDEC (3681 component, or a combination thereof, with 4054 recording). ... A file with information about 21971 variable stars. ...

Еще в разделе: (Показать все результаты (>11) - astrometric.sai.msu.ru/ )

• Symbolic circuit processor
• Symbolic matrix processor

... Форумы > Разное > Тема . ... Форумы Список тем Новая тема . ... Есть ли в электронном виде курс матанализа? ... Где можно достать курс Фихтенгольца? Ответить Цитировать . ... http://www.mistral.ru/content/36642.shtm . http://www.mistral.ru/content/36642.shtml . ... http://vilenin.narod.ru/Mm/Book/Book.htm . ... http://vilenin.narod.ru/Mm/Books/1/book. http://vilenin.narod.ru/Mm/Books/1/book.htm . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>51) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное | КРАСИВЫЙ номер
• MMOnline | Форумы | Разное | Студсоюз - это Мы!, или 'Посторонним вход

.

Еще в разделе: (Показать все результаты (>3) - prac-gw.sinp.msu.ru/ )

... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...

Еще в разделе: (Показать все результаты (>16) - phys.web.ru/ )

Skip to main content . ... ECFS . ... Форум Евразийского почвенного партнерства Forum . Евразийский центр по продовольственной безопасности МГУ рад приветствовать вас на странице Форума Евразийского почвенного партнерства. Skip courses . Skip course categories . Search courses: . Skip новости сайта . ... Skip Main menu . Сайт Евразийского центра по продовольственной безопасности . ... info@ecfs.msu.ru ...

Еще в разделе: (Показать все результаты (>2) - edu.ecfs.msu.ru/ )

• ECFS: Сайт Евразийского центра по продовольственной безопасности

... Spectral and kinetic parameters of phosphorescence of triplet chlorophyll a in the photosynthetic apparatus of plants. ... Spectral and kinetic parameters and quantum yield of IR phosphorescence accompanying radiative deactivation of the chlorophyll a (Chl a) triplet state were compared in pigment solutions, greening and mature plant leaves, isolated chloroplasts, and thalluses of macrophytic marine algae. ... This parameter is stable in leaves of different plant species. ...

Еще в разделе: (Показать все результаты (>44) - biochem.bio.msu.ru/ )

... Further tests of the radiocarbon method of age determination (1 3, 6, 8,1 0) for archaeological and geological samples have been completed. All the samples used were wood dated quite accurately by accepted methods. ... TABLE 1 Age Determinations on Samples of Known Age . ... Specific activities for samples of known age. ... The former sample was cypress wood and the latter acacia. ... This committee advised us what samples of known age to use for testing and greatly assisted us in procuring them. ...

Еще в разделе: (Показать все результаты (>87) - hbar.phys.msu.ru/ )

• Peters C., Knobel E., Ptolemy's Catalogue of Stars a revision of the
• newtrev2.htm

... Applications of Molecular Mechanics to Metal Complexes" . ... Molecular mechanics study of the mixed-ligand lanthanide complexes using Gillespie-Kepert model . ... Within MM-GK, the same parameters are applicable to complexes of different coordination numbers/polyhedra. ... Gillespie-Kepert model . ... Using derived computational parameters, we calculated the geometry of 39 lanthanide ion nonaaqua complexes, 6 octaaqua complexes and 18 beta- diketonate and aqua-beta-diketonate complexes. ...

Еще в разделе: (Показать все результаты (>30) - analyt.chem.msu.ru/ )

• Molecular Mechanics Calculations of beta-Diketonate, Aqua, And
• Ионные жидкости
• The Molecular Mechanic Approach to Coordination Compounds: Force Field Based on

... Parameters . ... Natural Satellites Data Center. Parameters and constants . ... Satellites of Mars . Satellites of Jupiter . Satellites of Saturn . Satellites of Uranus . Satellites of Neptune . Satellite of Pluton . Masses of satellites . Dimensions of satellites . Photometric parameters of satellites . Rotational parameters and poles . Orbital parameters of the outer satellites of Jupiter, Saturn, Uranus and Neptune . ...

Еще в разделе: (Показать все результаты (>23) - www.sai.msu.ru/ )

• Moscow Astronomical Plate Archives: Contents, Digitization, Current and
• Digitization of Moscow Plate Archives

Tsunami source parameters versus earthquake magnitude and depth: Monte Carlo simulation Mikhail Nosov and Anna Bolshakova M.V.Lomonosov Moscow State University, Faculty of Physics, Moscow, Russian Federation (m.a.nosov@mail.ru) European Geosciences Union General Assembly 2011 Vienna | ... Among all possible parameters of a tsunami source we consider only those parameters which can be unambiguously calculated from the vertical component of co-seismic bottom deformations. ...

Еще в разделе: (Показать все результаты (>16) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/science/nosov/EGU2010_pumping.pdf

... Новости . Объявления . Контакты . ... Расписание . О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . Расписание экзаменов 415 группы. ... Кафедра системного анализа ВМК МГУ создана в 1992 году. Организатор и заведующий кафедрой - лауреат Ленинской премии, заслуженный профессор МГУ, академик РАН Александр Борисович Куржанский . ...

Еще в разделе: (Показать все результаты (>4) - sa.cmc.msu.ru/ )

• Выпускники | Кафедра системного анализа ВМК МГУ
• Сотрудники кафедры | Кафедра системного анализа ВМК МГУ
• Send page by email | Кафедра системного анализа ВМК МГУ

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>31) - mailybaev.imec.msu.ru/ )

• Book review by Professor Wolfhard Kliem

php $ referer = getenv( HTTP_ REFERER ); if (!(preg_match( /genphys.phys.msu./ , $ referer ) || preg_match( / mikromag / , $ referer ))) { echo hacker? he-he...\n ; exit ; }//if require_once($GLOBALS[ DOCUMENT_ROOT ]. / mikromag /script/config.php3 ); function authenticate () { Header( WWW- authenticate : basic realm=' ... Иногда, для того чтобы браузер забыл старый логин и пароль надо перезагрузить браузер (закрыть все окна и загрузиться снова). ...

Еще в разделе: (Показать все результаты (>89) - genphys.phys.msu.su/ )

• http://genphys.phys.msu.su/rus/lab/mol/234/stat.cnt
• AtomPhysics
• IntroToQuantumPhysics