... Fish Physiology and Biochemistry [Fish Physiol Biochem] . Common information . ... 0.558 . ... since 1986-01-01 till today . ... http://www.springerlink.com/content/1.. ... 1986-01-01 . today . ... http://www.springerlink.com/content/1... 1995-05-01 . ... http://elibrary.ru/issues.asp?id=1285 . ...

Еще в разделе: (Показать все результаты (>211) - journals.genebee.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>2) - lab110.imec.msu.ru/ )

Open Conference Systems . Conference Help . ... Notifications . ... Conference Content Search . All Authors Title Abstract Index terms Full Text . ... By Conference . By Author . ... For Authors . Home . ... Search . Current Conferences . Home > Notification mailing list . Enter your email address to receive immediate notifications of important new content added to the conference. Email . ...

Еще в разделе: (Показать все результаты (>153) - hea.phys.msu.su/ )

• Account
• Organizing Team
• Notifications

Neutrino telescope in Northern Hemisphere . ... about ANTARES . ... ANTARES is the name of a neutrino telescope residing in the Mediterranean Sea off the coast of Toulon, France. ... Other neutrino telescopes designed for use in the nearby area include the Greek NESTOR telescope and the Italian NEMO telescope, which are both in early design stages. ... In contrast to the South Pole neutrino telescopes AMANDA and IceCube, ANTARES uses water instead of ice as its Cherenkov medium. ...

Еще в разделе: (Показать все результаты (>21) - antares.sinp.msu.ru/ )

... Text as Means of Cultural Exchange . Contents . Abstracts . ... Everyday Life as Text, American and Russian . ... American and Russian Experience in Cultural Myth-Making . ... Nation as Narration: Russian and American Experience . ... Culturally Constructed History . ... Summer School 2016 . Summer School Archives . ...

Еще в разделе: (Показать все результаты (>3) - discours.philol.msu.ru/ )

... Магистерское образование . ... Студенты . ... Курсы повышения квалификации . ... Sat, 04/09/2016 - 04:46 ? zavuch . ... В четверг, 31 марта 2016 г. занятия О.Р. Лапониной по курсу "Технологии и принципы обеспечения безопасности в сети интернет" - отменяются. ... Студенты магистратуры 2-го курса, до 15 февраля обязательно пришлите на почту темы вашей магистерской диссертации, заполнив форму План по НИР для студентов магистратуры. ... Телефоны: 8 (499) 216-50-50, 8 (495) 989-50-50 . ...

Еще в разделе: (Показать все результаты (>24) - hcs.cmc.msu.ru/ )

• The core courses for the specialty "Applied Mathematics and Computer Science".
• Master program "Mathematical and computer methods of image processing" |
• Master program "Software for Computer Networks" | Магистерское и послевузовское

O.G. Koshelev . In the last years we have developed new methods of measurement of the photoelectric parameters of silicon wafers used for solar cell fabrication. ... One of the methods permits to determine the photoelectric parameters of wafer without conductive electrodes. ... The method can be easily automatized. The methods were tested on silicon solar cells irradiated by fast particles. ... A nondestructive method for measuring the photoelectric parameters of wafers with p-n-junctions. ...

Еще в разделе: (Показать все результаты (>79) - scon155.phys.msu.su/ )

• A new method for determining parameters of the potential well of off-center
• First-principles calculations of physical properties of crystals

... Further tests of the radiocarbon method of age determination (1 3, 6, 8,1 0) for archaeological and geological samples have been completed. All the samples used were wood dated quite accurately by accepted methods. ... TABLE 1 Age Determinations on Samples of Known Age . ... Specific activities for samples of known age. ... The former sample was cypress wood and the latter acacia. ... This committee advised us what samples of known age to use for testing and greatly assisted us in procuring them. ...

Еще в разделе: (Показать все результаты (>90) - hbar.phys.msu.ru/ )

• Peters C., Knobel E., Ptolemy's Catalogue of Stars a revision of the

... solvation nucleation of the polymorphs Solute-solute interactions, association parameters , thermodynamics parameters , conformations growth of the crystal Nature of solvent, intermolecular interactions (solute ґ solvent, solute-solute), conformations Lattice energy , entropy of the crystal, symmetry of the lattice, conformations The conformational manifolds is the candidate to be a coordinate of reaction Methods of investigations Quantum chemistry ...

Еще в разделе: (Показать все результаты (>13) - www.elch.chem.msu.ru/ )

Страница поддержки курса "Архитектура ЭВМ и язык ассемблера" для 1 потока . ... Ассемблер nasm . ... Программа курса . ... Компьютерные системы: архитектура и программирование. 1 издание . ... Итоги коллоквиума ?1 . ... Коллоквиум ?1 . ... Итоги экзамена и всего курса . ... Результаты коллоквиума ?1 . ... Older posts . Posted on 05.04.2016 by vartan . ... 5) Записать на языке ассемблера выражение с побочными эффектами, заданное на языке Си . ... Архитектура ЭВМ и язык ассемблера . ...

Еще в разделе: (Показать все результаты (>24) - asmcourse.cs.msu.ru/ )

• vartan | Архитектура ЭВМ и язык ассемблера
• Установка cygwin | Архитектура ЭВМ и язык ассемблера
• nasm @ linux | Архитектура ЭВМ и язык ассемблера

Mikushin, D.N., and V.M. Stepanenko. The implementation of regional atmospheric model numerical algorithms for CBEA-based clusters. Lecture Notes in Computer Science, Parallel Processing and Applied Mathematics, Vol. 6067, 2010, p. 525-534. ... Target ing the next generation of MPI-CellBE hybrid cluster architectures, out method aims to provide additional scalability to MPI-based codes of atmospheric models and related applications . ...

Еще в разделе: (Показать все результаты (>103) - srcc.msu.ru/ )

• A. Goncharsky. Some problems of computer tomography in wave approximation. //
• Oseledets I.V., Tyrtyshnikov E.E. Algebraic wavelet transform via quantics
• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... education . ... Composite materials . Materials for solar and fuel cells . ... Registration deadline is 30 April 2012. ... New deadline is 15 May 2012 . ... Registration fee should be paid before 10 June 2012. ... For information please contact Mrs. Olga Bogomolova: obogomol@gmail.com and Dr. Alexander Chertovich: chertov@polly.phys.msu.ru . ...

Еще в разделе: (Показать все результаты (>14) - nano.msu.ru/ )

• Registration for the International School ?Computer simulation of advanced

... Randles impedance. Interfacial capacitance. ... Partial currents ik in the bulk solution are determined by transport numbers tk . ... dl Thermodynamics of interfaces ґ binary solution : 2 independent variables, e.g. = +/z+ - -/zsolution: dE+ = ( Cdl )-1 d - t -dl d(/F) d+ = - t+dl d - Cdl d(/F) EDL: + , d- = - t -dl d + Cdl d(/F) metal : THREE independent interfacial parameters: (1) Cdl , interfacial capacitance ( capacitance of the electrical double layer ), (2) t+dl et t-dl , ...

Еще в разделе: (Показать все результаты (>63) - electr003.chem.msu.ru/ )

• RADEN Data Bank
• Pages of history: Eh-Film
• Galina A. Tsirlina: Eduard L. Nagaev. Scientific heritage

... Полная версия: Выступления ансамбля Студии . Грация-МГУ::Форум > Мультимедия > Видео . ... Nov 10 2006, 05:27 . Добавил на сайт две записи с выступлениями ансамбля "Грации-МГУ" . http://grace.msu.ru/content/view/70/26/ . ... Opera 9.01 - полет нормальный... http://www.youtube.com/watch?v=L6smD7_GibQ . http://www.youtube.com/watch?v=xY7lUnopZYU . ...

Еще в разделе: (Показать все результаты (>23) - grace.msu.ru/ )

• Выступления ансамбля Студии - Грация-МГУ::Форум
• Грация-МГУ::Форум > Технические работы на сервере
• Грация-МГУ::Форум > интересно интервью со Славиком Крикливым и Анной...

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Подписаться на новости . ... Computer Science . ... Software engineering for mobile devices . ... Design and development of middleware (collaboration system, context-aware system, content system) on mobile devices . Design and development of applications on mobile devices . ... 2) Embedded OS porting, system programming, Mobile OS . ... 5) Location-based service on mobile devices . ...

Еще в разделе: (Показать все результаты (>54) - www.physcareer.ru/ )

• Software Engineer (Server) / Вакансии / Physcareer.ru
• Software Engineer (Backend Servers / Web / WAP / Вакансии / Physcareer.ru
• Software Engineer (C/C++ and JAVA) / Вакансии / Physcareer.ru

... Пример: ?Ни фига себе сайт $shocked$?. ... Link] 31.07.06 11:46:19 I/O Admin : . ... Наш сайт теперь включен в Каталог Яндекса!! ... META http-equiv="Content-Type" content="text/html; charset=windows-1251">. ... Link] 16.07.06 15:42:32 Site Content Admin : . Пора готовить сайт к началу учебного года. ... Link] 29.06.06 00:25:01 AlexeY : . ... META http-equiv="Content-Type" content="text/html; charset=win-1251"> . ... Присылайте свои материалы, пополняйте коллекцию, пожалуйста! ... 2016, DMVN . ...

Еще в разделе: (Показать все результаты (>38) - www.dmvn.mexmat.net/ )

Skip to main content . ... ECFS . ... Форум Евразийского почвенного партнерства Forum . Евразийский центр по продовольственной безопасности МГУ рад приветствовать вас на странице Форума Евразийского почвенного партнерства. Skip courses . Skip course categories . Search courses: . Skip новости сайта . ... Skip Main menu . Сайт Евразийского центра по продовольственной безопасности . ... info@ecfs.msu.ru ...

Еще в разделе: (Показать все результаты (>2) - edu.ecfs.msu.ru/ )

• ECFS: Сайт Евразийского центра по продовольственной безопасности

... Practical courses . ... The architecture of data acquisition and control systems systems and laboratory works employs various types of plug-in boards, CAMAC modules, GPIB boards, original connecting cards and virtual generators, breadboard modules, and sound blasters, which are used as generators of analog signals of different shapes and as analog-to-digital converters. ... Pascal and C++ are employed to program the different blocks of data acquisition and control systems systems. ...

Еще в разделе: (Показать все результаты (>113) - ilc.phys.msu.ru/ )

• Публикация
• Laboratory of computer simulations in optics
• Grant detail

... Research . ... Linguistic expeditions . ... Up to now the subjects to documentation were local dialects of Selkup, Ket, and Evenki. ... 1) creation and enlargement of multimedia computer archives of Selkup, Ket, and Evenki speech, which include sounding dictionaries and folklore texts and life-stories in audio, video, and graphic representation in local dialects of the surveyed villages; development of linguistic multimedia databases; . ... 8) research into the Selkup-Ket-Evenki language contacts; ....

Еще в разделе: (Показать все результаты (>35) - lcl.srcc.msu.ru/ )