... UHECR SINP MSU . ... TUS . ... mini-EUSO (UV atmosphere) . News . UHECR news . TLE news . Lab's news . Publications . Publications UHECR . ... For students . Our students . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . JEM-EUSO Extreme Universe Space Observatory on the Japanese Experiment Module (JEM) of the International Space Station . ... JEM-EUSO is a new type of observatory that uses the earth's atmosphere as a detector. ...

Еще в разделе: (Показать все результаты (>38) - uhecr.sinp.msu.ru/ )

• Scientific relations
• TLE news
• Lab's news

... There is no trigger -- channels are sampled continuously and written first to disk, later to tape Total data rate from each interferometer: ~3 MB/sec Gravitational wave channel is only ~2% of the data stream Data to be archived: ~100-200 TB per year ACAT 2002 Peter Shawhan ( LIGO / Caltech ) Gravitational-Wave Data Analysis Different scientific topics require different ...

Еще в разделе: (Показать все результаты (>62) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/kodolova/acat.pdf
• http://acat02.sinp.msu.ru/poster-sessions.html

Sergey Vladimirovich Petrushanko Afflilation and official address: Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow State University Leninskiye Gory, Moscow 119991, Russia E-mail: sergeant@mail.cern.ch Date and place of Birth: 24 March 1975, Sverdlovsk (USSR) Citizenship: Russian Federation Education: 2002 Ph.D. (High energy physics ) Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow ...

Еще в разделе: (Показать все результаты (>134) - lav01.sinp.msu.ru/ )

... education . ... Thu, 18/07/2013 - 01:09 ? ... С 19 по 22 августа 2013 года в Лондонском центре нанотехнологий состоится седьмая международная студенческая нанотехнологическая конференция . The London Centre for Nanotechnology, a joint venture between University College London and Imperial College London, will be hosting the 7 th INASCON (International Nanoscience Student Conference) from the 19 th ? 22 nd August 2013. ... Registration is open until 1 st August 2013. ...

Еще в разделе: (Показать все результаты (>41) - nano.msu.ru/ )

• The 2nd Russian-Japanese Young Scientists Conference on NanoMaterials and

Integration of Fuzzy c-Means Clustering algorithm with PostgreSQL database management system" . Miniakhmetov R.M., Tsymbler M.L. The integration of data mining algorithms with relational database management systems (DBMS) is a topical issue. ... This paper suggests an implementation of Fuzzy c-Means Clustering algorithm for the PostgreSQL open-source DBMS. ... Keywords: fuzzy clustering, integration clustering algorithms with relational DBMS . PostScript (in Russian) (787KB) . ...

Еще в разделе: (Показать все результаты (>500) - num-meth.srcc.msu.ru/ )

• "Identification algorithms for substances in the hybrid database on molecular
• "Correction of solar dopplergrams' large-scale flatfield"
• "Effective buffer management replacement algorithm for parallel shared-nothing

Technical >> Network (Archive) . ... cepesh : Re: Синхронизация времени [re:september26] 24.04.2003 19:00 | ... fartein.ifi.uio.no=Norway, University of Oslo . ... bitsy.mit.edu=USA, MA, Cambridge, MIT Information Systems . nic.near.net=USA, MA, Cambridge . ... otc1.psu.edu=USA, PA, Penn State University . ... timex.cs.columbia.edu=USA, NY, New York, Columbia University . ... clock-1.cs.cmu.edu=USA, PA, Pittsburgh, Carnegie Mellon University . ... у меня стоят gw.local, ns.msu.ru и ns.msu.net . ...

Еще в разделе: (Показать все результаты (>5306) - www.fds-net.ru/ )

• Chemists, Attention! Search on databases! - Public forum of MSU united student
• ISPA Engineering - Public forum of MSU united student networks
• Java Swing, Database - Public forum of MSU united student networks

... The article is devoted to the position of the Russian language in Eastern Europe. ... The purpose of this study is to assess the prospects of the Russian language in Eastern Europe, taking into account the processes of European integration. ... Russian language, Eastern European countries, language policy, European Union, multilingualism, language status, strengthen the position of language. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>262) - ee-journal.spa.msu.ru/ )

Unfortunately, the English version of our site is much less developed than the Russian version. ... Library of Electronic Publications . ... The Institute for Time Nature Explorations web site is established by the Russian Interdisciplinary Temporology Seminar , which has been operating at M. V. Lomonosov's Moscow State University since 1984. The creation and continued maintenance of the institute were and are made possible through the support of the Russian Fund of Basic Research, grant No. ...

Еще в разделе: (Показать все результаты (>440) - chronos.msu.ru/ )

• Status of the Institute
• Home - Institute for Time Nature Explorations
• Russian Interdisciplinary Temporology Seminar

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>22) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Here is a list of previous events held by our Department. April 23, 2012 . Round Table Repeated Speech: Between a Commonplace and an Artistic Experiment held as a part of the Lomonosov Readings conference. ... Lecture Language, Culture and Hegemony: Rethinking the Politics of Culture in the ?б??ntext of the Russian Revolution . ... Round Table . ... November 30, 2011 . ... Round Table Reading a Monument: A Memorial Place in the City (held as a part of the conference Polyphony of the City ). ...

Еще в разделе: (Показать все результаты (>12) - discours.philol.msu.ru/ )

... 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . ... The CLEOR/Europe-EQEC 2005 Conference will take place from 12 to 17 June 2005 at the International Congress Center Munich, Germany . ... Please note that the deadline for the submission of the papers is 7 January 2005. ... Conferences Manager . ... CLEO(R)/Europe-EQEC 2005, Conference on Lasers and Electro-Optics and European Quantum Electronics Conference, 12-17 June 2005, Munich, Germany www.cleoeurope.org ....

Еще в разделе: (Показать все результаты (>756) - ofvp.phys.msu.ru/ )

• EPS-QEOD Europhoton Conference
• Сайт кафедры общей физики и волновых процессов
• Laboratory of Quantum Information

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>4) - apollo.sai.msu.ru/ )

• MASTER-II Kislovodsk
• Dome Kislovodsk Database ::
• Astelco Kislovodsk Database ::

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>7) - compmech.math.msu.su/ )

1.1 Protons and He-ions by GOES spacecrafts data (Telescope and DOME instruments) are selected from: . http://ngdc.noaa.gov/stp/ . ... 1.2 High-energy heavy ions (Z = 6, 7, 8, 10, 12, 14, 16, and 26) by ACE spacecraft (SIS instrument) data are selected from: . ... Database is interpreted and composed by Dr. phys. and math. R. Nymmik /Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University/ . Website design is composed by A. Sobkanyuk /Lomonosov Moscow State University/ . ...

Еще в разделе: (Показать все результаты (>2242) - swx.sinp.msu.ru/ )

• Index of /models/database/progdata
• Index of /models/database/db/000912
• Index of /models/database/db/010402

... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...

Еще в разделе: (Показать все результаты (>2) - sa.cs.msu.ru/ )

... These functions build the foundation for accessing Berkeley DB style databases. This is a general abstraction layer for several file-based databases. As such, functionality is limited to a common subset of features supported by modern databases such as Sleepycat Software's DB2 . ... When invoking the dba_open() or dba_popen() functions, one of the following handler names must be supplied as an argument. ... dbm . Dbm is the oldest (original) type of Berkeley DB style databases. ... db2 . ...

Еще в разделе: (Показать все результаты (>407) - oit.cmc.msu.ru/ )

• fbsql_database_password
• yaz_database
• Persistent Database Connections

... PhDi . ... SOFTWARE PACKAGE FOR CALCULATIONS OF PHASE DIAGRAMS . elaborated and developed by laboratory scientists) . The software package contains a database of thermodynamic properties for about 200 systems and a software based on a so called convex hulls approach. ... binary systems in coordinates Temperature - Composition at fixed pressure and Pressure ? ... Colloquium on 24.12.12 20 Dec 2012 . ... Colloquium on 23.11.12 22 Nov 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• Carbamide Laboratory of Chemical Thermodynamics
• Lora S. Nikolaeva Laboratory of Chemical Thermodynamics
• Gallery Laboratory of Chemical Thermodynamics

Division Information . ... Site Information . ... Analytical Chemistry Division at the Department of Chemistry, M. V. Lomonosov Moscow State University is the leading Russian center in analytical science and education . ... Division comprises of 5 research laboratories and education lab facilities. ... Postal address: Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University, Leninskie Gory 1, 119899 Moscow, Russia . ... Chemistry Department of Moscow State Univesity . ...

Еще в разделе: (Показать все результаты (>53) - analyt.chem.msu.ru/ )

... Ph.D. in Physics and Mathematics (Theoretical and Computational Chemistry), Department of Chemistry, M.V.Lomonosov Moscow State University . M. Sc. in Chemistry, Department of Chemistry, M. V. Lomonosov Moscow State University (2000), Thesis: "Ab initio study of equilibrium structures and vibrational spectra of molecular clusters". ... Undergraduate Student, Department of Chemistry, M. V. Lomonosov Moscow State University (1995-2000). ... Quantum and Computational Chemistry; . ... autumn 2001. ...

Еще в разделе: (Показать все результаты (>19) - lcc.chem.msu.ru/ )

• Laboratory of Chemical Cybernetics

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey