... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... https://cs.msu.ru/node/1707 . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>15) - ani.cmc.msu.ru/ )

• Prof. Dmitry P. Kostomarov at the Differential Equations and Topology
• Courses | Department of the Automation for Scientific Research CMC MSU
• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the

. Название публикации . Nuclear Magnetic Resonance Spectroscopy in Solving the Analytical Problems of Medicine: Analysis of Cerebrospinal Fluid . Авторы . T.N. Kolokolova, O.Yu. Savel'ev, N.M. Sergeev, O.A. Shpigun, K.V. Sokolov, V.I. Skvortsova . Дата . 31.12.2009 23:00:00 . Название журнала . Journal of Analytical Chemistry. Том . Vol.65 . Номер . 10. первая страница . 1073 . последняя страница . 1081. Купить нет на складе . 2009 ФФМ МГУ, 2009

Еще в разделе: (Показать все результаты (>12) - fbm.msu.ru/ )

Summary Progress Report 2010 ґ 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...

Еще в разделе: (Показать все результаты (>47) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf
• http://fgp.msu.ru/wp-content/uploads/2015/10/Congress_program_pdf.pdf

Announcement On November 2-3, 2005 Lomonosov Moscow State University will conduct jointly with the Academy of Cryptography of the Russian Federation the Fourth All- Russian Conference Mathematics and Security of Information Technologies [Cybersecurity?] and jointly with the Center of International Studies, Cambridge University , United Kingdom, Advanced Research Workshop Unconventional ... Sherstyuk V.P. - Security Council of the Russian Federation; 3. ... Organization Committee 1. ...

Еще в разделе: (Показать все результаты (>12) - suny.msu.ru/ )

• http://suny.msu.ru/ru/ProgramMaBIT05En.doc
• Center on Russia and the United States :: Other Russian Programs

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>45) - www.msm.biophys.msu.ru/ )

... Data . ... Solar energetic particles . ... Projects . ... Neutron flux variations (RU) . ... InterHelio-Zond . ... INTERHELIO-Zond PROJECT . ... INTERHELIO-Zond project is being developed within the framework of the Federal Space Program of the Russian Federation . It is aimed at the research of the Sun from close distances including inner heliosphere and solution of the problems of solar corona heating, acceleration of the solar wind, origin of the solar flares and coronal mass ejections. ...

Еще в разделе: (Показать все результаты (>12) - smdc.sinp.msu.ru/ )

... Furman and A.V.Tikhonravov, "Basics of optics of multilayer systems" , Editions Frontiers, Gif-sur Yvette, 1992, 242 p. A.V. Tikhonravov, M.K. Trubetskov, I.V. Zuev and P.G. Verly, "Efficient Refinement of Inhomogeneous Optical Coatings", in "Optical Interference Coatings", OSA Technical Digest Series, vol. ... A.V. Tikhonravov, M.V. Klibanov, I.V. Zuev, "Numerical study of the phaseless inverse scattering problem in thin film optics", Inverse problems, 1995, Vol. 11, pp. ... Основные публикации . ...

Еще в разделе: (Показать все результаты (>13) - www.srcc.msu.ru/ )

e mail: theory@socio.msu.ru) M. Weber, Weber's methodology, the concept of the ideal type and to assign values of cause-effect (causal) explanation of the historical patterns, clean and medium types, the problem of interpretation, the relationship between statistics and complementarity, comparative-historical method, . ...

Еще в разделе: (Показать все результаты (>80) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2010/2/06.pdf
• http://www.socio.msu.ru/vestnik/archive/2012/4/01.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/2/07.pdf

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ґ velocity potential, H ґ depth, ґ vector of bottom deformation, 0 ґ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>12) - ocean.phys.msu.ru/ )

. Клуб выпускников МГУ (Московский Государственный Университет) . Abstract: The problem of truth in science - the most urgent problem of our time - is discussed . Добавить сообщение . Страница сайта http://www.moscowuniversityclub.ru . Оригинал находится по адресу http://www.moscowuniversityclub.ru/services/messages.asp?forumId=0 =8488 .

Еще в разделе: (Показать все результаты (>241) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Конференция "Выпускники МГУ в США"
• Клуб выпускников МГУ: О вреде мобильных телефонов, радиотелефонов, WIFI, СВЧ
• Клуб выпускников МГУ: Обратить седину вспять

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Compression project . ... The goal is to design algorithm for automatic saliency maps construction for real-life video examples . ... Most of the existing methods are designed for still images . ... Content-aware compression . Content-aware quality estimation . ... We get probability of features extracted from binarized saliency maps using Relevance Vector Machine[3] . ... New methods development . ...

Еще в разделе: (Показать все результаты (>135) - graphics.cs.msu.ru/ )

• Keyframe-based Depth Compression (Update) | Graphics and Media Lab
• Keyframe-based Depth Compression | Graphics and Media Lab
• Video Matting Benchmark | Graphics and Media Lab Equation Equation Equation

M. A. Vorotyntsev 1 1,2,3, D. V. Konev3, M. Skompska 4 ICMUB-UMR 6302 CNRS, Universite de Bourgogne, Dijon, France 2 M. V. Lomonosov Moscow State University, Russia 3 Institute for Problems of Chemical Physics, Chernogolovka, Russia 4 University of Warsaw, Poland mivo2010@yandex.com, mv@elch.chem.msu.ru, mv@u-bourgogne.fr In situ measurements of specific conductivity of films on electrode surface Specific conductivity: function of potential Impedance problems: 1. ... Which thickness? ...

Еще в разделе: (Показать все результаты (>55) - electr003.chem.msu.ru/ )

• Laboratory of Electrical Double Layer and Electrode Kinetics

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>5) - compmech.math.msu.su/ )

• Список публикаций - Е. Б. Кудашев - Кафедра вычислительной механики
• Список публикаций - А. Н. Козлова - Кафедра вычислительной механики

DOI: 10.7256/2222-1972.2014.5.14682 doi ? ?: ( ) : . ... 526 ? NOTA BENE ( ?-?) ? ? XI ., ... 527 ? NOTA BENE ( ?-?) : 5 (23) Ї 2014 DOI: 10.7256/2222-1972.2014.5.14682 . ... XVIґXVIII . ... NOTA BENE ( ?-?) DOI: 10.7256/2222-1972.2014.5.14682 , [1, 7]. ... 529 ? NOTA BENE ( ?-?) : 5 (23) Ї 2014 DOI: 10.7256/2222-1972.2014.5.14682 ґ , : ? , " "?. ... NOTA BENE ( ?-?) DOI: 10.7256/2222-1972.2014.5.14682 , ? ? [14, 155]. ... NOTA BENE ( ?-?) 533 : 5 (23) Ї 2014 DOI: 10.7256/2222-1972.2014.5.14682 27. ...

Еще в разделе: (Показать все результаты (>9) - www.hist.msu.ru/ )

Lomonosov Moscow State University was established in 1755 . ... Full member of the Russian Academy of Science Mathematics Department, Applied Mathematics and Computer Science Section (1997, corresponding member since 1994). Bureau member of the Russian Academy of Science Mathematics Department (1996). Member of the Russian Academy of Science Presidium (1996). Victor Sadovnichy started his working life in 1956 as a loader and timberman at the Komsomolets mine (Gorlovka, Donetsk region). ...

Еще в разделе: (Показать все результаты (>71) - www.msu.ru/ )

• The scheme of an arrangement of MSU buildings on Leninskiye Gory
• Research Priorities in Sciences and Humanities at Moscow State University
• Faculty of Soil Science

... Boris A. Grishanin is an Associate Professor in the Department of Physics, M.V.Lomonosov Moscow State University (MSU). He received his M.S. and Ph.D. degrees from MSU in 1963 and 1968, respectively (both in Physics). ... B. A.Grishanin's current research interests are in the field of quantum theory of open systems, laser physics, molecular dynamics of photoexcited molecules, problems of quantum information and quantum computing. ... Information theory . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>69) - qilab.phys.msu.ru/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Reactivity thermoelectric clathrate compounds in interaction with components of the air . The project aims to address the fundamental problems of solid state chemistry - revealing the fundamental regularities of the reactivity of crystalline phases in reactions with air components and processes of formation of oxide layers (coatings) for new materials. ...

Еще в разделе: (Показать все результаты (>20) - www.lssm.inorg.chem.msu.ru/ )

... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...

Еще в разделе: (Показать все результаты (>6) - lab106.imec.msu.ru/ )

Homotopy types of moment-angle complexes based on joint work with Jelena Grbic, Stephen Theriault and Jie Wu Taras Panov Lomonosov Moscow State University The 39th Symposium on Transformation Groups Tokyo University of Science, Japan, 23ґ25 November 2012 Taras Panov (MSU) Homotopy typ es of m-a complexes Tokyo 24 Nov 2012 1 / 15 1. ... Taras Panov (MSU) Homotopy typ es of m-a complexes Tokyo 24 Nov 2012 2 / 15 2. ... The number of commutators of length Taras Panov (MSU) is equal to ( - 1) . ...

Еще в разделе: (Показать все результаты (>136) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/~asmish/Lichnaja-2010/Version2010-11-20/Grants/Grants_en.htm
• Topology section
• Conferences (English)