О кафедре . Сотрудники . ... Публикуем материалы сотрудников кафедры . ... Кафедра математических и компьютерных методов анализа создана приказом ректора МГУ в 2008 году. ... Сотрудники кафедры проводят научные исследования в следующих областях: аналитическая теория чисел, математический анализ, теоретико-числовые методы в криптографии, сложность вычислений, компьютерная криптография, компьютерная геофизика. ... 2016, Кафедра математических и компьютерных методов анализа. ...

Еще в разделе: (Показать все результаты (>2) - mkma.math.msu.su/ )

Effective Algorithm of Charge State Determination in Electrospray Ionization Fourier Transform Ion Cyclotron Resonance Mass Spectra of Humic Substances Erast V. Kunenkov1, Andras Gaspar2, Alexey S. Kononikhin3, Philippe Schmitt-Kopplin2, Irina V. Perminova1 ... ESI FTICR mass spectrum of HS contains about ten thousands of peaks in mass range 250­1200 Da (the most intensive peaks are usually located near 400 Da) with tenths of peaks, appeared at each nominal mass with high regularity. ...

Еще в разделе: (Показать все результаты (>192) - mgumus.chem.msu.ru/ )

• MGUMUS -- First International Conference on Humics-based Innovative
• MGUMUS -- Andrey I. Konstantinov
• IHSS-14

MGU Botanic Garden . ... MSU Botanical gardens branch 'Pharmaceutical garden' . ... Metro station Universitet , buses: 1, 113, 661, descend at the 'DK MSU' stop, buses 119, 67, 103, 130, 187, 260, trolleybus 34, descend at the stop 'Mendeelskaya st.'. 15-20 min from the metro station to the gates of the Garden. Metro st 'Kievskaya', bus 119, descend at the stop 'Mendeevskaya st', 30 min from the metro station to the gates of the Garden . ... MSU Botanical Garden: 'Pharmaceutical Garden' branch:: . ...

Еще в разделе: (Показать все результаты (>19) - botsad.msu.ru/ )

• Ботанический сад Московского университета

... News . About choir . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Bishop Tikhon opened the choir of Moscow State University in Vienna . Choir of Moscow State University spoke at the Vienna branch of the United Nations . ... Posted in: News . Sorry, this entry is only available in Русский . ... Newer Entries . ...

Еще в разделе: (Показать все результаты (>11) - new.choir.msu.ru/ )

• News | Academic choir of Moscow State University
• Conductor | Academic choir of Moscow State University
• Concerts | Academic choir of Moscow State University

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... Contact Us . All partners . ... Faculty of Journalism, . ... Please contact the respective department prior to your visit and make an appointment. Below are frequently contacted departments at the Faculty of Journalism. If you need to contact a particular academic department, look for the contact information here:љ Academic departments . ... Contacts : journ.editor@gmail.com . ...

Еще в разделе: (Показать все результаты (>171) - www.journ.msu.ru/ )

• News :: Department of Journalism, M. V. Lomonosov Moscow State University <span
• Media-partners :: Department of Journalism, M. V. Lomonosov Moscow State
• Full-time programs :: Department of Journalism, M. V. Lomonosov Moscow State

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>6) - physcontrol.phys.msu.ru/ )

ВМиК-Online! ... Поиск . ... лекция старшего вице-президента Microsoft . ... Future Directions in Computer Science . ... 2001 2012 ВМиК Online! ... Поиск по сайту . ... Комментарии и предложения присылайте на адрес info@cmc online.ru . ...

Еще в разделе: (Показать все результаты (>96) - www.cmc-online.ru/ )

• ВМиК - Online! : Работа для выпускников и студентов ВМК МГУ - Вакансии компании
• ВМиК - Online! : Работа для выпускников и студентов ВМК МГУ - Kelly Services

. Webcams . Networking . Weather . Power . System health . Measurements . Copyright 2007 2013.

Еще в разделе: (Показать все результаты (>46) - curl.sai.msu.ru/ )

• atmos 3.0 page

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Practical courses . ... The architecture of data acquisition and control systems systems and laboratory works employs various types of plug-in boards, CAMAC modules, GPIB boards, original connecting cards and virtual generators, breadboard modules, and sound blasters, which are used as generators of analog signals of different shapes and as analog-to-digital converters. ... Pascal and C++ are employed to program the different blocks of data acquisition and control systems systems. ...

Еще в разделе: (Показать все результаты (>201) - ilc.phys.msu.ru/ )

• Laboratory of computer simulations in optics
• Practice
• Laboratory of solid-state lasers and coherent spectroscopy

... Moscow State University Belozersky Institute of Physico-Chemical Biology . The Department of Electron Microscopy offers positions in the area of molecular biology of the cell for excellent and highly motivated biologists at under-graduate or post-graduate level. Students : We are constantly offering diploma thesis and PhD thesis projects for students in cell biology and biophysics. The applicant is expected to have a strong interest in either experimental activity or computer modeling. ...

Еще в разделе: (Показать все результаты (>9) - cellbiol.genebee.msu.ru/ )

... Faculty of Physics . ... Online journals . ... Access to the E-library is open from any computer in the intranet of the Faculty connected to the Internet. ... URL link: http://www.iop.org/EJ/ These journals can be accessed on-line from any computer in the intranet connected to the Internet. ... URL link: http://www.elsevier.com/wps/find/journal_browse.cws_home/P12?pseudotype= =Title 1Code=P12 =A These journals can be accessed on-line from any computer in the intranet connected to the Internet. ...

Еще в разделе: (Показать все результаты (>86) - www.phys.msu.ru/ )

• Faculty Staff
• Library of the Faculty of Physics

... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...

Еще в разделе: (Показать все результаты (>8) - phys.msu.su/ )

MSU . Science Park . ... Science Park was established in 1990 by the Academic Board of Moscow State University. MSU Science Park provides search services for locating partners, finance and employees for innovation projects. ... The MSU Science Park Mission is to stimulate innovation within the university with activities designed to bring about structural changes in Moscow?s economy. ... University, Technopark Skolkovo Technopark Strogino and Innovation Development Center in Moscow. ...

Еще в разделе: (Показать все результаты (>15) - www.sciencepark.ru/ )

• MSU Science Park - About us
• MSU Science Park - Venue & Space
• MSU Science Park - Companies

... Air temperature in the forechamber: 285-295K . ... Aerodynamic unit AR-2 is used for experimental research of heat and mass exchange processes in a model boundary layer, flown over by supersonic air stream. The main part of the unit is supersonic aerodynamic tube of continuous action with regulated plate nozzle, rectangular cross-section of the working part 100x70 and with regulated exit cone. ... Unit AR-2 is a supersonic aerodynamic tube with a regulated supersonic nozzle and an exit cone. ...

Еще в разделе: (Показать все результаты (>8) - termogaz.imec.msu.ru/ )

• MAU_main_e

INTERNATIONAL CONFERENCE . February 26 - March 05, 2006, Moscow, Russia . ... Moscow State University . Institute of Mechanics of MSU . ... It follows the tradition of biannual confer-ences organized by the Institute of Mechanics of Moscow State University between 1976 and 2004 (see http://hit2003.narod.ru/ ), which were widely attended by scientists and students from the former Soviet Union. ... Phone, E-mail and Fax. ... Institute of Mechanics, Moscow State University . ...

Еще в разделе: (Показать все результаты (>28) - hit-conf.imec.msu.ru/ )

• Nonlinear Problems of Gydrodynamic Stability Theory
• Untitled
• Index of /2006/CD

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>311) - mouse.belozersky.msu.ru/ )

• Index of /npidb/pdb
• Index of /npidb/pdb/html_scop
• Index of /npidb/data/pdb_new

Sergey Vladimirovich Petrushanko Afflilation and official address: Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow State University Leninskiye Gory, Moscow 119991, Russia E-mail: sergeant@mail.cern.ch Date and place of Birth: 24 March 1975, Sverdlovsk (USSR) Citizenship: Russian Federation Education: 2002 Ph.D. (High energy physics ) Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow ...

Еще в разделе: (Показать все результаты (>64) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~vlk/LECT_2015_new/lect_12_2015_quarkinia_Y1_Y2_Y3.pdf

... продам Apple AirPort Express Base Station = 800 руб . ... До 11 Мбит/с для компьютеров с AirPort и другими совместимыми с Wi-Fi стандартом 802.11b картами (скорость пересылки зависит от условий окружающей среды) . ... Обычно 15 метров от базы при скорости передачи данных 54 Мбит/с (радиус действия зависит от здания, в котором используется AirPort Express) . ... Re: продам Apple AirPort Express Base Station [ re: St000 ] . ... Re: продам Apple AirPort Express Base Station = 800 руб [ re: St000 ] . ...

Еще в разделе: (Показать все результаты (>7187) - www.snto-msu.net/ )

• play station 2 - Public forum of MSU united student networks
• Помогите установить Windows XP Mode в Windows 7 - Public forum of MSU united
• проблема с завершением работы в Win XP - Public forum of MSU united student

... CLEANSOIL . ... Therefore, the system is applicable to the remediation of soil below buildings, roads, pipelines, railroads, etc, for both local and/or diffuse contamination, and even for preventive applications. to develop and to test an innovative, simple, easy to handle, applicable under existing infrastructures and cost-effective on-site and in-situ soil remediation method able to achieve a degree of soil remediation that allows its reutilisation for different purposes; . ... http://soil.msu.ru ...

Еще в разделе: (Показать все результаты (>34) - eco.soil.msu.ru/ )

• Norwegian-Russian cooperation in the border area
• Forest ecosystem data in Norwegian-Russian border area
• THEORETICAL BASES AND EXPERIMENTAL ANALYSIS OF SOIL SOLUTION TRANSFORMATION