... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

. Backlinks to FAQSimultaneousEdits in System Web ( Search all webs ) . UserDocumentationCategory . A List of User Documentation $ AccessKeys : Access keys are keyboard shortcuts which allow the user to navigate around a website or a piece of computer software ... NEW - 02 Sep 2010 - 17:49 by ProjectContributor . Number of topics: 1 . Copyright by the contributing authors. All material on this site is the property of the contributing authors. Ideas, requests, problems regarding Foswiki? Send feedback

Еще в разделе: (Показать все результаты (>48903) - wiki.cmc.msu.ru/ )

• (backlinks in System Web) FileAttribute < System < Foswiki
• (backlinks in all Webs) FileAttribute < System < Foswiki
• (backlinks in all Webs) HiddenAttachment < System < Foswiki

. Backlinks to HiddenAttachment in System Web ( Search all webs ) . UserDocumentationCategory . A List of User Documentation $ AccessKeys : Access keys are keyboard shortcuts which allow the user to navigate around a website or a piece of computer software ... NEW - 02 Sep 2010 - 17:49 by ProjectContributor . Number of topics: 1 . Copyright by the contributing authors. All material on this site is the property of the contributing authors. Ideas, requests, problems regarding Foswiki? Send feedback

Еще в разделе: (Показать все результаты (>23264) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) FileAttribute < System < Foswiki
• (backlinks in System Web) FileAttribute < System < Foswiki
• (backlinks in System Web) FAQSimultaneousEdits < System < Foswiki

Invisible Higgs in weak bosons associative production with heavy quarks at LHC Sergei Demidov Institute for Nuclear Research RAS in collaboration with E. Boos (SINP MSU) and D. Gorbunov (INR RAS) 9 September, 2010 E. Boos, D. Gorbunov, S. Demidov (INR RAS) Invisible Higgs 9 September, 2010 1 / 15 Introduction Standard Model. ... 2003) Why does missing pT come from Higgs boson? ... V via q q VV scattering where q is Higgs mass range mH < 2MV , vir tual Higgs, probing the Higgs width H . ...

Еще в разделе: (Показать все результаты (>164) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2015/Chesnokov_QFTHEP%202015.pdf
• http://qfthep.sinp.msu.ru/talks2013/QFTHEP-Golovnev.pdf
• http://qfthep.sinp.msu.ru/talks2013/tsirova_qfthep_2013-06-25.pdf

. To see a Russian version of this page, click here . (Professor, Director of SAI. Graduated from the Moscow State University (MSU) in 1964, Ph.D. 1967, MSU, Dr. of Science 1975, MSU) . A member of IAU and EAS, IAU committees No 42, 27. Fields of interest: Stellar astrophysics, close binary systems, inverse problems in astrophysics. Send your mail to: cher@sai.msu.su .

Еще в разделе: (Показать все результаты (>17) - uranus.sai.msu.ru/ )

• Igor Antokhin
• Tatjana Khruzina
• Linux on CLEVO 8750

... The Second International Astronomy Olympiad . ... Problems to solve, 8-10 Form Text of these problems is available in Russian too. ... Two stars have the same absolute magnitude. ... The orbital period of Mars is 687 days. ... See problem 2. for 8-10 Form. ... Problem to solve, 9-12 Form Text of the problem is available in Russian too. ... Problem is about Doppler-effect, to find velosities of two stars using their spectra and spectrum of our Sun, to estimate speed of the Earth moving around the Sun...

Еще в разделе: (Показать все результаты (>26) - www.issp.ac.ru/ )

• IO of EAAS, Problems to solve (In Russian)
• II IO of EAAS, Problems to solve (In Russian)
• Gavrilov M.G. "Zviozdnyj Mir" (in Russian), problems 339-344

... On-line консультант . ... Место работы, должность: Преподаватель, старший научный сотрудник Лаборатории Вычислительных комплексов ВМК МГУ имени М.В.Ломоносова . ... D. Gamayunov, R. Smeliansky. ... 2002. (in Russian) . D. Gamayunov, A. Kachalin. ... In proceedings of the fifth Russian Applied and . ... detectors of computer attacks for corporate networks. ... I. Bulgakov, D. Gamayunov, E. Toroschin, Detecting network worms . ... Опыт работы по тематике магистратуры: 9 лет (руководство . ...

Еще в разделе: (Показать все результаты (>19) - erp.cmc.msu.ru/ )

... Dr. G. Koptsik . ... Aim of this project is to develop a tool to quantify the risks of excess inputs of heavy metals to agricultural and forest ecosystems. ... Geographically the accent will be put on agricultural and forest ecosystems of the Northern (Kola Peninsula) and Central (Upper Oka-river basin) parts of Russia. ... Koptsik G.N., Nalbandyan K.F. 2002. ... Koptsik, S., Koptsik, G., and Eruslankina, L. Heavy metals in subarctic forest ecosystems: soil pollution and impacts on plant diversity. ...

Еще в разделе: (Показать все результаты (>24) - eco.soil.msu.ru/ )

• Koptsik G.N., et al. Soils of the National Park "Russian North".

Копировать из putty текст в буфер обмена и обратно . ... Например, если неправильно ввели в интерактивном режиме программы EMBOSS какой-нибудь параметр и не хотите продолжать - зарубите ее, нажав Ctrl-C. Вызывать аналог far (Midnight Commander) прямо в putty . ... less . Искать в less какое-нибудь слово . ... Чтобы выйти из less, надо нажать q. Напоминаю также, что когда вы говорите "man что-то" или "tfm что-то", то текст руководства у вас тоже показывается в less, так что слеш можно использовать. ...

Еще в разделе: (Показать все результаты (>8613) - kodomo.fbb.msu.ru/ )

... Студенты, обладающие визой F-1 в Соединенных Штатах Америки , теперь могут сделать изменения, объявленные в апреле, в программе Общего практического обучения. Срок программы обучения был продлен от 12 месяцев до 29 и теперь позволяет определенным студентам визы F-1 работать в США по профессиям, относящимся к области обучения студентов. ... Data Processing and Data Processing Technology/Technician. ... Architectural Engineering Technology/Technician. ... Civil Engineering Technology/Technician. ...

Еще в разделе: (Показать все результаты (>951) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Конференция "Вакансии"
• Клуб выпускников МГУ: Обсуждение материала "CRISIS IN THEORETICAL PHYSICS: THE

Software Protection: How to Crack Programs, and Defend Against Cracking" In the first part of this course we will learn how to "crack" programs, i.e.how hackers break into software to extract secrets, remove license checks, etc. ... Learning about this type of computer security is important because many current systems are vulnerable to cracking attacks. ... The course will have practical homework exercises where you will crack small programs, and use tools to protect against cracking. ...

Еще в разделе: (Показать все результаты (>6) - master.cmc.msu.ru/ )

. [ Войти ] . Главная -> Фильмы -> Computer Boy . Пользователи . Демо . Деньги . Фильмы . Форум . Computer Boy . Австралия 2000 . отметить . Комедия . Триллер .

Еще в разделе: (Показать все результаты (>422) - kinfo.ru/ )

• The Computer Wore Tennis Shoes - Фильмы - Kinfo.ru
• The Story of Computer Graphics - Фильмы - Kinfo.ru
• Problem Child - Фильмы - Kinfo.ru

... News from the UNESCO Chair on Global Problems . ... ABOUT THE CHAIR . ... GENERAL INFORMATION ABOUT THE CHAIR . ... STAFF OF THE CHAIR . ... NETWORK OF THE CHAIR . ... Школа ЮНЕСКО / UNESCO SCHOOL . Визит Генерального директора ЮНЕСКО . ... Home News from the UNESCO Chair on Global Problems . ... 2005-2013 Факультет глобальных процессов МГУ имени М.В. Ломоносова / Исполнение и поддержка ресурса: Союз молодых ученых и специалистов Евразии ...

Еще в разделе: (Показать все результаты (>5) - unesco.fgp.msu.ru/ )

• ОБЩАЯ ИНФОРМАЦИЯ О КАФЕДРЕ ? GENERAL INFORMATION ABOUT THE CHAIR Кафедра ЮНЕСКО
• Кафедра ЮНЕСКО по изучению глобальных проблем на факультете глобальных

SVETKA, a program for analysis of different alignments . Back to the help page . ... Such a feature can look like " Leucine in the position 362 of the alignment of the entire family " and can, in many cases, be a "decision rule" to distinguish sequences from two sides of a tree branch. ... Comparing the alignment with an input tree (the tree may be entered by the user or reconstructed with the WPGMA algorithm), the program detects supporting positions of the alignment for every branch the tree. ...

Еще в разделе: (Показать все результаты (>1011) - monkey.belozersky.msu.ru/ )

• About authors ot this complex

Alexandra A. Zobova . NAME: Alexandra A. Zobova . ... AFFILIATION: Associate Position, Department of Theoretical Mechanics and Mechatronics, . Faculty of Mechanics and Mathematics, . Lomonosov Moscow State University . ADDRESS: Alexandra A. Zobova , . ... Moscow State University, 2008 . ... Laboratory Training for the students of the Theoretical Mechanics and Applied Mechanics and Control Departments . Lecture Course on 'Dynamics of the Systems of Solid Bodies with Friction' . ...

Еще в разделе: (Показать все результаты (>4) - www.theormech.math.msu.su/ )

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>19) - lcc.chem.msu.ru/ )

• Laboratory of Chemical Cybernetics
• Research Interests
• People

... PhD thesis title: Gauge dependence of effective action in quantum gravity. ... Research fields of interest . Combustion: nonlinear development of the Darrieus-Landau instability of premixed flames, nonlinear flame stabilization and steady flame propagation, asymptotic methods, small gas expansion limit, non-perturbative description of curved flames, flame propagation in gravitational field, propagation of diffusion flames in counterflows. ... Gauge-independent effective gauge fields. ...

Еще в разделе: (Показать все результаты (>11) - theorphys.phys.msu.ru/ )

ВМиК-Online! ... Поиск . ... лекция старшего вице-президента Microsoft . ... Future Directions in Computer Science . ... 2001 2012 ВМиК Online! ... Поиск по сайту . ... Комментарии и предложения присылайте на адрес info@cmc online.ru . ...

Еще в разделе: (Показать все результаты (>32) - www.cmc-online.ru/ )

• ВМиК - Online! : Работа для выпускников и студентов ВМК МГУ - Вакансии Intel
• ВМиК - Online! : Работа для выпускников и студентов ВМК МГУ - Вакансии компании
• ВМиК - Online! : Новости - Издательство Springer предоставляет двухмесячный

... Информационный портал о карьере и работе для студентов и выпускников технических и естественнонаучных специальностей . ... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... Management Information System (MIS) analyst, Junior systems analyst. Management Information System (MIS) analyst (reference code 'MIS') . Job profile: . Personal Installment Loans (PIL) & Credit Cards (CC) MIS development & maintenance . ... PIL & CC Ad-Hoc MIS Ideal candidate's profile: . ...

Еще в разделе: (Показать все результаты (>143) - www.physcareer.ru/ )

Sergey A. Ayvazyan Methods of Econometrics Introduction Dear reader, You have a textbook in your hands on methods of econometrics, one of the three basic disciplines of higher economic learning, along with micro- and macroeconomics. In Russia, unfortunately, the status of econometrics was recognized belatedly: econometrics was introduced into the study programs of economic learning in several leading Russian higher educational institutions only since 1992. ...

Еще в разделе: (Показать все результаты (>29) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/sc_pub/presman_sc_pub_2011_en.pdf
• http://www.mse-msu.ru/Nekipeliv_31012011.pdf
• http://www.mse-msu.ru/sc_pub/presman_sc_pub_2011.pdf