Sergey A. Ayvazyan Methods of Econometrics Introduction Dear reader, You have a textbook in your hands on methods of econometrics, one of the three basic disciplines of higher economic learning, along with micro- and macroeconomics. In Russia, unfortunately, the status of econometrics was recognized belatedly: econometrics was introduced into the study programs of economic learning in several leading Russian higher educational institutions only since 1992. ...

Еще в разделе: (Показать все результаты (>22) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf
• http://www.mse-msu.ru/images/Sapir_trnslt.pdf

... Посетите Сервер по Физике . ... Анонсы конференций . Написать комментарий . ... Конференция "Very High Multiplicity Physics" в Дубне . ... С 7 по 9 апреля этого года в Дубне пройдет конференция "Very High Multiplicity Physics". Конференция посвящена памяти Леонида Слепченко, работавшего в Дубне и Тбилиси. Среди тем, которые будут обсуждаться на конференции коллективные явления, фракталы, статистическая физика. ... Copyright 2000-2015, РОО "Мир Науки и Культуры". ISSN 1684-9876 . ...

Еще в разделе: (Показать все результаты (>389) - www.nature.web.ru/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... New approaches to the synthesis of hybrid materials InP - organic stabilizer . ... To replace the membranes using standard samples CT InP, myristic acid, stabilized, and samples heterostructures InP / ZnSe with two monolayers Accrued zinc selenide and also stabilized myristic acid. ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>39) - www.lssm.inorg.chem.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Guidelines for Paper Submission . ... The program committee will schedule both oral and poster sessions. The abstract and summary of both oral and poster papers are published in the same manner in the Conference Program and the Technical Digest on CD-ROM. ... Oral Sessions . ... Poster Sessions . ... For poster sessions, authors are provided with bulletin boards on which to display their papers, along with a sign indicating their paper numbers, and pushтАУpins or adhesive tape. ... Program . ...

Еще в разделе: (Показать все результаты (>22) - iconolat13.phys.msu.ru/ )

• Program topics
• Registration info
• Conference venue

Stephen Price (Southampton U) Q: The difference of theoretical and experimental patterns is rather high, why? The difference between the experimental and theoretical patterns is large in the case of the Cu and Pd EXAFS because only the first nearest neighbour shell is fit, that only the atoms within 3 е of the absorber. In contrast, the Au EXAFS is fit up to 6 е and so the theoretical and experimental patterns is much less. ... Q: What was the technology of underpotential deposition? ...

Еще в разделе: (Показать все результаты (>36) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/probst.pdf
• http://www.elch.chem.msu.ru/mole/lecture/kiselev.pdf
• Molecular aspects of solid state and interfacial electrochemistry

. To view the high resolutiuon photos press the images. Attention! The size of each photo is from 1.5 to 2.5 MBytes. Home page

Еще в разделе: (Показать все результаты (>35) - rswater.phys.msu.ru/ )

• Laboratory of laser spectroscopy of solutions of supramolecular compounds and
• Dmitry M. Karpov

... Gildan Activewear?s CEO Discusses Q2 2012 Results . Good day, ladies and gentlemen, and welcome to the Q2 2012 Gildan Activewear Earnings Conference Call. ... Earlier this morning, we issued a press release announcing our earnings results for the second quarter of fiscal 2012. ... cheap the north face . ... the north face outlet uk . ... cheap north face . ... http://www.janvier-europe.co.uk/the-north-face-outlet-uk-best-outlet-malls-in-the-dc-area-cbs-dc.html . ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>103) - elana.sinp.msu.ru/ )

• leave the radio off. Is actually why so frequency higher any unusual noises.
• cheap michael kors Cyclacel Pharmaceuticals? CYCC CEO Spiro Rombotis on Q2 2015

... Абасова (Чучкова) Галина Александровна . ... Абрамов Евгений Александрович . ... Абросимов Сергей Александрович . ... Аваева Татьяна Маратовна . ... Авдиевич Татьяна Михайловна . ... Аветисова Анна Александровна . ... Александр Иванов Александрович . ... Алексеев Александр Валентинович . ... Андреев Александр Николаевич . ... Андреева Галина Александровна . ... Андреева Ольга Александровна . ... Андреева Татьяна Владимировна . ... Андреева Татьяна Константиновна . ... Аниканов Александр Юрьевич . ...

Еще в разделе: (Показать все результаты (>28) - www.guru.ru/ )

... Полная версия этой страницы: Schools on High Energy Physics . Студенческий форум Физфака МГУ > Наука физика > Конференции, семинары и другие мероприятия . ... Думаю многим, особенно младшекурсникам будет полезно. ... Правда, на 2010 год, но на 2011 тоже несложно найти думаю.. ... Для просмотра полной версии этой страницы, пожалуйста, пройдите по ссылке . ...

Еще в разделе: (Показать все результаты (>500) - wasp.phys.msu.ru/ )

• Schools on High Energy Physics - Студенческий форум Физфака МГУ
• Студенческий форум Физфака МГУ > Higgs boson lighter than previously predicted
• Студенческий форум Физфака МГУ > Vendor Management PM

... International Olympiad БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ... The Olympiad allows the participation of primary, secondary and high school students, BSc, MSc, PhD students, young scientists, teachers and tutors, or enthusiasts of materials sciences and nanotechnologies . ... The site www.nanometer.ru is the official portal of the International Olympiad on nanotechnologies БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ...

Еще в разделе: (Показать все результаты (>2) - www.fnm.msu.ru/ )

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>6) - sinp.msu.ru/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... Download script: memgen-0.0.1.tar.gz System requirements: python 2 (2.6 and higher), python openbabel library, python numpy library. ... continue reading..... ab initio basis sets cp2k education Firefly FRAP GAMESS gromacs MDAnalysis membrane mmb nano OPLS pymol python scipy sparse matrix toolset topology познавательно учебные материалы . OPLS-AA patch for different types of molecules . ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>30) - erg.biophys.msu.ru/ )

• python ERG Research Group: Лаборатория теоретической биофизики
• Python membrane generator for MD simulations ERG Research Group: Лаборатория

. Name . Last modified . Size . Description . Parent Directory . - . Hbond_1A1L.pdb1.xls . 2009-08-06 22:08 . 8.0K . result.txt . 2009-08-06 22:08 . 1.1K . Apache/2.4.10 (Debian) Server at monkey.belozersky.msu.su Port 80

Еще в разделе: (Показать все результаты (>10) - monkey.belozersky.msu.su/ )

• Index of /npidb/pdb/results/480cbee9-1c7b-43f8-9f4a-4608cfab4b12
• Index of /npidb/pdb/results/6e2add40-6dee-4b72-8147-8694fdbdb763
• Index of /npidb/pdb/results/761d8cc5-4592-4fe2-bc90-86ae73ddfdf3

. Name . Last modified . Size . Description . Parent Directory . - . Hbond_1A1L.pdb1.xls . 2009-08-06 22:08 . 8.0K . result.txt . 2009-08-06 22:08 . 1.1K . Apache/2.4.10 (Debian) Server at npidb.belozersky.msu.ru Port 80

Еще в разделе: (Показать все результаты (>14) - npidb.belozersky.msu.ru/ )

• Index of /data/results/480cbee9-1c7b-43f8-9f4a-4608cfab4b12
• Index of /data/results/6e2add40-6dee-4b72-8147-8694fdbdb763
• Index of /data/results/761d8cc5-4592-4fe2-bc90-86ae73ddfdf3

. Name . Last modified . Size . Description . Parent Directory . - . Hbond_1A1L.pdb1.xls . 2009-08-06 22:07 . 8.0K . result.txt . 2009-08-06 22:07 . 1.1K . Apache/2.4.10 (Debian) Server at monkey.belozersky.msu.ru Port 80

Еще в разделе: (Показать все результаты (>455) - monkey.belozersky.msu.ru/ )

• Index of /npidb/pdb/results/bfdb206c-1fba-41dd-ab78-c7856d9e377c
• Index of /npidb/pdb/results/761d8cc5-4592-4fe2-bc90-86ae73ddfdf3
• Index of /npidb/pdb/results/2c38dd60-ed04-4229-b205-305f9c9eff80

. Name . Last modified . Size . Description . Parent Directory . - . Hbond_1A1L.pdb1.xls . 2009-08-06 22:07 . 8.0K . result.txt . 2009-08-06 22:07 . 1.1K . Apache/2.4.10 (Debian) Server at mouse.belozersky.msu.ru Port 80

Еще в разделе: (Показать все результаты (>6958) - mouse.belozersky.msu.ru/ )

• Index of /npidb/pdb/results/b0791641-fa77-4395-a018-9ef619ed3782
• Index of /npidb/pdb/results/bfdb206c-1fba-41dd-ab78-c7856d9e377c
• Index of /npidb/pdb/results/a6ca9f1f-ec7f-4ff6-a3f0-9f31ece2e4f1

... Vice-Dean, Physics Department, M.V.Lomonosov Moscow State University . Vice-Director, International Laser Center, M.V.Lomonosov Moscow State University . ... International Laser Center and Faculty of Physics . ... Radiophysics including Quantum Electronics . ... Victor Zadkov's current research interests are in the field of laser physics, interaction of laser radiation with matter, molecular dynamics of photoexcited molecules, coherent control, quantum optics and physics of quantum information. ...

Еще в разделе: (Показать все результаты (>76) - qilab.phys.msu.ru/ )

by Margarita Dzhalalova It is known that the pressure difference values for a round parachute are constant over total canopy, then for a square parachute the values of pressure difference are non-uniform along radial ribbons differing even from each other and depending mainly on certain sets of line lengths, and therefore square parachutes attain different shapes from each other ( Fig.1 - photo of var.1 and var.2). ... Distribution of pressure coefficient along radial ribbons of square parachute. ...

Еще в разделе: (Показать все результаты (>6) - margaret.imec.msu.ru/ )

• teachers

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...