Lomonosov Moscow State University, Faculty of Mechanics and Mathematics, English Department On Borsuk's problem by A. Lukina, group 305, English teacher: A.A.Savchenko 1. ... It studies combinatorial properties of finite or discrete bodies or bodies with some particular characteristics, for instance, of a certain diameter. ... A number of questions arise from this problem. ... It is useful to deal with not just a body of diameter one, but with its approximation, called universal cover system. ...

Еще в разделе: (Показать все результаты (>18) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Academic_English_part3.pdf
• http://www.eng.math.msu.su/download/theses3.pdf

... Вычисление приближения к псевдорешению системы линейных алгебраических уравнений на множестве неотрицательных векторов. Для системы линейных алгебраических уравнений: A * x = B . ... Englewood Cliffs, New Jersey, 1974. int aln1r_c (real *a, integer *mda, integer *m, integer *n, real *b, real *x, real *rnorm, real *w, real *zz, integer *index, integer *ierr) . ... index - . ... index(1) до index(nsetp) = множество P . index(iz1) до index(n) = множество Z . ...

Еще в разделе: (Показать все результаты (>765) - num-anal.srcc.msu.ru/ )

• БЧА НИВЦ МГУ. ALD1R_C. Специальные задачи линейной алгебры
• Ресурсы Интернет по численному анализу
• БЧА НИВЦ МГУ. ALD1R_P. Специальные задачи линейной алгебры

... ВШБ МГУ - школе . ... Japanese Expert Takes a Stab at Moscow Traffic . ... Former Japanese Prime Minister Yukio Hatoyama faced the prospect of being stuck in Moscow rush-hour traffic perhaps for hours after his plane landed late at Domodedovo Airport. ... The presentation of a new book by Hatoyama's son on how to solve Moscow's traffic jams. The book, "Moscow: Traffic Problems of a Megalopolis," does not suggest a police escort as a solution to the city's cataclysmic traffic problems. ...

Еще в разделе: (Показать все результаты (>87) - www.mgubs.ru/ )

• Вестник Московского университета | Высшая школа бизнеса МГУ им. Ломоносова

... Приз в 1 миллион долларов за решение каждой из семи математических проблем . ... Научная лаборатория школьников . ... CMI - The Clay Mathematics Institute (Кембридж, Штат Массачусетс) - назвал семь нерешенных математических проблем - "Millennium Prize Problems", за решение каждой из которых будет выплачен $1 млн. К . 16.01.2003 Проблема Кука . ... Научная Сеть . ...

Еще в разделе: (Показать все результаты (>152) - www.nature.web.ru/ )

• На следующей неделе в Протвино состоится 24-я Международное совещание по физике
• Theoretical Computer Science: взгляд математика
• Приз в 1 миллион долларов за решение каждой из семи математических проблем

. # ....... # S ....... S T ..... E R . Q U E . C N ..... T C ....... U # ....... R E ..... E S . S .

Еще в разделе: (Показать все результаты (>2) - mouse.belozersky.msu.ru/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Reactivity thermoelectric clathrate compounds in interaction with components of the air . The project aims to address the fundamental problems of solid state chemistry - revealing the fundamental regularities of the reactivity of crystalline phases in reactions with air components and processes of formation of oxide layers (coatings) for new materials. ...

Еще в разделе: (Показать все результаты (>19) - www.lssm.inorg.chem.msu.ru/ )

... Under physiological conditions, nucleoside diphosphate kinase (EC 2.7.4.6, NDPK) catalyzes the reactions of nucleoside triphosphates synthesis from ATP and the respective nucleoside diphosphates. ... During the last years, we have studied properties and functions of NDPK in the outer compartment of rat liver mitochondria. ... Why did we decide to study NDPK of the outer compartment of rat liver mitochondria? ... T.Y. Lipskaya (2001) Biochemistry (Mosc), 66, 115 - 129. ...

Еще в разделе: (Показать все результаты (>13) - biochem.bio.msu.ru/ )

• Sulfated and sulfonated polymers are able to solubilize efficiently the protein
• [application of the analytical transmission electron microscopy techniques for

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... DRIVER: To develop a model of the interstellar hydrogen distribution in the heliosphere. To apply this model for the analysis of experimental data from different spacecraft. ... The results of the simulations of the formation and evolution of molecular clouds can be used as initial conditions for the current star formation in galaxies. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>41) - hpc.msu.ru/ )

• APPLICATIONS: Plasma Physics | Moscow University Supercomputing Center
• X-COM: DISTRIBUTED COMPUTING SOFTWARE | Moscow University Supercomputing Center
• APPLICATIONS: Theoretical Physics | Moscow University Supercomputing Center

Home People Activities Research Publications . Yurin's home page . ... Юрин Д.В. "Расчетно-параметрическое исследование флуктуаций сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // Автореферат диссертации на соискание ученой степени кандидата физико-математических наук (специальность 01.04.03-радиофизика). ... Юрин Д.В. "Метод расчета статистических характеристик сигнала обратного рассеяния при лазерном зондировании взволнованного моря " // В кн. ...

Еще в разделе: (Показать все результаты (>18) - imaging.cs.msu.ru/ )

... Mathematical Theory of Feedback Control . ... Annotation: this course is about mathematical equations of atmospheric diffusion which allow modeling of the problems of environment. ... The course reflects the experience and the point of view of a research group in the field of mathematical modeling of Western, Soviet and later Russian economics. ... Such approach captures the behavior of rather complex systems. ... Scientific Seminar: Mathematical Modeling of Complex Systems . ...

Еще в разделе: (Показать все результаты (>17) - hcs.cmc.msu.ru/ )

• Master program "Mathematical Models of Complex Systems" | Магистерское и
• The core courses for the specialty "Applied Mathematics and Computer Science".
• Mathematical models and methods in VLSI design | Магистерское и послевузовское

... Processes of regionalization in Post-Soviet space: contradictions of Russia-Belarus Integration. Moscow, Institute of economy RAS, 2010. ... Eurasian Economic Integration. ­ 2010, 1. 4. 10 years of EurAsEC: everything is just starting (in co-authorship with R. Grinberg)./ ... Scientific Reports of the Institute of Economics of RAS. ... Analytical Bulletin of the Centre for Problems of Globalization and Integration of Institute of economics of Russian Academy of Sciences", 2007, Issue 4 (12). ...

Еще в разделе: (Показать все результаты (>17) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/sc_pub/presman_sc_pub_2011.pdf
• http://www.mse-msu.ru/Nekipelov_France_2010_Slides_Eng.pdf

... Course Name . ... Software Development for Computational Problems . ... Prof. Fedor S. Zaitsev . Data Analysis Methods . ... Computational Physics and Nanotechnology . ... Assoc. Prof. Igor N. Inovenkov . Mathematical Models for Dynamic Processes . ... Prof. Igor V. Zotov . ... One-Dimensional Problems of Mathematical Physics . ... Two-Dimensional Problems of Mathematical Physics . ... Maple for Mathematical Physics Problems . ... Source URL: http://ani.cs.msu.su/en/courses . ...

Еще в разделе: (Показать все результаты (>6) - ani.cs.msu.su/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU
• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on

... Студенческая Астрономическая обсерватория ГАИШ . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... For those really interested in galaxies, extragalactic astronomy or the aspects of cosmology we study, we can always find an interesting problem to work on. ... To make your work in the Group most effective, it would be useful to study the following courses read by our group members as well as the members of other groups in our and other institures. ... Student information . ...

Еще в разделе: (Показать все результаты (>10) - www.sai.msu.ru/ )

• Отдел внегалактической астрономии: ГАИШ Extra-galactic astronomy Group Staff
• Отдел внегалактической астрономии: ГАИШ Extra-galactic astronomy Group

FemtoScan 001 - FAQ . Russian version . ... How to build a histogram for a part of image . ... How to copy and print files seen in Quick View . Quick View Parameters and other options . About Macros . ... Choose the command Parameters in the menu View or in the popup menu, which appears after pressing the right button of the Mouse. ... All the images seen in Quick View . ... QuickView] - Legend view, seen on the images of Quick View , number of images ( Show All Images ) . ...

Еще в разделе: (Показать все результаты (>40) - www.spm.genebee.msu.ru/ )

• FIMIS
• Scanning Probe Microscopy Image Processing Software User's Manual FemtoScan
• Client

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>11) - belyakov.imec.msu.ru/ )

... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>37) - nanofluidics.phys.msu.ru/ )

• Research

... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...

Еще в разделе: (Показать все результаты (>2) - sa.cs.msu.ru/ )

О кафедре . ... Иванов А.О., Тужилин А.А. Разветвленные геодезические. ... Иванов А.О., Тужилин А.А. Лекции по классической дифференциальной геометрии. ... Иванов А.О., Ильютко Д.П., Носовский Г.В., Тужилин А.А., Фоменко А.Т. Компьютерная геометрия: практикум. ... Иванов А.О., Тужилин А.А. О деформации многообразия, уменьшающей объем с максимальной скоростью, и ее приложении в теории гравитации. ... Иванов А.О., Тужилин А.А. Конспекты лекций по дифференциальной геометрии и топологии. ...

Еще в разделе: (Показать все результаты (>81) - dfgm.math.msu.su/ )

• Иванов А.О. / Кафедра Дифференциальной геометрии и приложений /
• Жеглов А.Б. / Кафедра Дифференциальной геометрии и приложений /
• Titles of talks

... Географии мирового хозяйства . ... Выберите кафедру . ... Кафедры . ... Key words: evolution problems of geography, the Brownian motion, glaciers, lakes, palaeoclimate, uneven rotation of the earth, anomalies of temperature and salinity. ... Alexeenko N.A. Maps of nature management conflicts for the design of nature protection areas of regional and local importance . ... Key words: design of nature protection areas, nature management conflicts. ... Key words: regional nature management, Dagestan . ...

Еще в разделе: (Показать все результаты (>193) - www.geogr.msu.ru/ )

• Instructions for Authors, contributing to “GEOGRAPHY, ENVIRONMENT,
• CONTENTS ? 1 - 2012
• pyynj

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )