... История кафедры . ... младших курсов . ... Уважаемые студенты 1-го, 2-го и 3-го курсов! ... Семинар кафедры проходит по пятницам в 15.20 в комн. ... а также на стендах кафедры на 2-м и 4-м этажах. Информацию о более ранних событиях см. в разделе "Жизнь кафедры" . ... 119991, Москва, Ленинские горы, д.1, стр.2, МГУ имени М.В.Ломоносова, физический факультет, кафедра фотоники и физики микроволн . ...

Еще в разделе: (Показать все результаты (>15) - photonics.phys.msu.ru/ )

• Department of Photonics and Microwave Physics - Faculty of Physics of Lomonosov
• Сотрудники - Кафедра фотоники и физики микроволн МГУ

All these programs are written on FORTRAN 77. ... Listing of the main routine, the function and the results ( fig4_2.txt ). Listing of the subroutines ( listing_01.txt , listing_01.zip ). ... The block (the main routine, the function and the subroutines (+general)). ( application_01.zip ). ... General programs. ... All listings of the subroutines ( all_listings.zip , all_listings.txt ) and the main routines with the functions and the results ( all_figures.zip , all_figures.txt ). ...

Еще в разделе: (Показать все результаты (>13) - foroff.phys.msu.ru/ )

... lang=='en'?' ... Скачать...') .' '; if ($lang == 'en') { block($dscs[$id]['encap'], date('Y/m/d h:i A', $dscs[$id]['time']).' | ... удалить ', $s); } } } function drawfolder($id) { global $flds; global $lang; if (isset($flds[$id])) { $s = ' . ... Open':'Открыть') .' '; if ($lang == 'en') { block($flds[$id]['encap'], date('Y/m/d h:i A', $flds[$id]['time']).' | ... удалить ', $s); } } } function drawparent($id) { global $flds; global $lang; if (isset($flds[$flds[$id]['parent']])) { $s = ' . ...

Еще в разделе: (Показать все результаты (>2) - osa.phys.msu.ru/ )

• http://osa.phys.msu.ru/a_news.php

... Field of interest: Theory of quantum measurements. ... It is proposed the new method of quantum nondemolition measurement of energy of optical wave in waveguide using effect of quadratic scattering of electron or atom. ... Measurement of excess noise in the suspension fiber for a gravitational wave detector'', Physics Letters A , A227 , 159-164 (1997). ... Thermodynamical fluctuations and photo-thermal shot noise in gravitational wave antennae'', Physics Letters A , A264 , 1-10 (1999). ...

Еще в разделе: (Показать все результаты (>61) - hbar.phys.msu.ru/ )

• CHAPTER VI

What would you like to search for? ... Case sensitive Match whole word Recent publications first . ... What to do if you are looking for ... words iron and oxide in the same record: iron and oxide . both these words or chemical formulae: (iron and oxide) or Fe2O3 . ... That's why do not use Co instead of cobalt : you will find Co even in al co hol! ... The hidden part of the database allows you to use full names of chemical elements instead of the short ones (like nickel instead of Ni ). ...

Еще в разделе: (Показать все результаты (>2) - scon155.phys.msu.ru/ )

First Russian Conference "OZONE AND OTHER ENVIRONMENT FRIENDLY OXIDANTS. ... 7-9 June 2005, Moscow . ... State of Art and Perspectives of Ozone Application for Water Treatment in Russian Federation . ... The foreign as well as the native ozonizers are used at these stations. ... State Univ. ... The report on the impulse corona ozonizer (Russian Scientific Centre 'Kurchatov Institute', 'NTC ECOS', Moscow) with ozone synthesized from the undrained air was presented to the participants of the Workshop. ...

Еще в разделе: (Показать все результаты (>8) - www.kge.msu.ru/ )

• Техпомощь

... Russia as well as other countries of the world was actively combating the economic downturn. ... And the country still has an amount of reserves that will feed us for several years to come. ... Countries of South-East Asia, China develop dynamically. Even in crisis times their growth rate made 8%. ... We, on the contrary, practice a very conservative approach the reserves are a kind of sacred cow: they cannot be used for anything except exchange rate regulation, which is erroneous. ...

Еще в разделе: (Показать все результаты (>11) - www.mse-msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... When we are talking about the North-South system, we should notice the difference between the problems of the North-South and Western systems. The North-South system is separate from the Western system because it deals with "lower incomes and resources bases of the developing countries" (Joan Spero 149). ... The North-South issue was discussed by the three different philosophical schools, which argued whether this gap could be reduced in the modern economic system. ...

Еще в разделе: (Показать все результаты (>42) - www.prof.msu.ru/ )

• RUSSIA UNDER PUTIN
• Conditons of democratization of youth work

Design of compounds combining various fragments affecting tubulin polymerization and depolimerization as promising oncolytic agents . Tubulin is a building block of microtubules that are formed during cell division. ... We develop interesting compounds that combine various tubulin-active structural blocks, e.g., fragments of taxol, colchicin and their analogs. ... Home . Research . Antitumor compounds . ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>6) - qsar.chem.msu.ru/ )

обзор! astro-ph/0207130 . ... Author: Bertil Dorch . Comments: Invited review, IAU coll. ... В обзоре рассматривается трехмерное моделирование магнитных трубок на Солнце. ... Comments: 55 pages, 35 figures -- low resolution figures to allow upload to astro-ph High-resolution version at http://www-sgk.harvard.edu:1080/~sylvain/preprints/ . ... Comments: 6 pages, 4 figures, Astron Nachr (accepted; proceedings of "1st Potsdam Thinkshop on Sunspots and Starspots", Potsdam, Germany, May 2002) . ...

Еще в разделе: (Показать все результаты (>29) - astro.uni-altai.ru/ )

12'2003 : 2'2003 . ... 2.1) A -- , C -- , . 1.1) n x= i=1 hi cos(i t), (2.2) i -- , hi -- . ... M 0 0 A = 0 Izz Izx , 0 Ixz Ixx rz , rx -- OZ OX , Lz , Lx -- OZ OX (. ... M -- ; Ixx , Izx , Izz -- : 1 - rx L-1 rx L-1 - rz L-1 x x z - L -1 L= L -1 x z 0 L -1 z . ... L x z 1000 2 1.74 13.2 / 16.84 / 28.3 / -4.01 · 10 -1.44 · 10 -2.04 · 10 -6.79 · 10 -1.28 · 10 -6.61 · 10 -5.40 · 10 2.68 · 10 2.08 · 10 -4 , % 0.01 0.1 0.1 0.01 0.01 0.01 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 3. ... 2002. ...

Еще в разделе: (Показать все результаты (>5) - belyakov.imec.msu.ru/ )

Current Issue About us Editors Board of Editors Guidelines Contacts . ... 2015 . ... Submit your article . ... Ph.D., associate professor, School of Public Administration, Lomonosov Moscow State University. ... Those risks are primarily associated with pollution: chemically altered composition of water, air pollution, formation of landfill sites, noise pollution, etc. ... This article outlines such trends as eco-tourism, the emergence of eco-settlements, eco-cities, as well as eco-countires. ...

Еще в разделе: (Показать все результаты (>56) - ee-journal.spa.msu.ru/ )

Index of Journals and Publishers . You can find some material through alphabetical list, here are publisher's and journal's lists. ... Main journals" list contains the most significant science magazines, like Nature , Cell , Science , PNAS and etc.. Physico-chemical biology" list contains magazines whitch is used very often by biologists of Belozersky institute, it had been gathered by Vladimir Melgunov. The "Classification" allows you to watch all journal in specific category. ...

Еще в разделе: (Показать все результаты (>3) - journals.genebee.msu.ru/ )

• JCatalog search page

... 1920- . ... 1921 . ... 1925 . ... 1928 . ... 1928­1929 . 1929 . ... 1930 . ... 1933 . ... 1937 . ... 1920 1921 . ... 1929 , 1931 . ... 1934­1936 . 1932­1933. ... 28.09.1925­17.09.1926. ... 1925­1928. ... 1929­1930 . ... 1935) « » « » ( 1937). ... 1928­1970. ... 1930­1940. ... 1931­1934 .: ... 8 ­ () 1934. ... 1933­1934. ... 1934­1937. ... 1937­1962. ... 1968­1970. ... 1965­1970, 79 . ... 1925­1962 . ... 1970­1978. ... 1966­ 1970. ... 1920- 1960- . ... 1930­1970. ... 1970­1976. ... 1970. ...

Еще в разделе: (Показать все результаты (>7) - lcl.srcc.msu.ru/ )

... Run source ./setup.csh 6. ... When you will start to work next time, run setups in following order : cd /data1/atlas/work source ../software/12.0.8/setup.csh cd testarea/12.0.8/ source $ATLAS_ROOT/../work/cmthome/setup.csh -tag=12.0.8 To exclude first two lines, just add to your .login these lines : # add Atlas env-s : source /data1/atlas/software/12.0.8/setup.csh After that next time just do : source $ATLAS_ROOT/../work/cmthome/setup.csh -tag=12.0.8 cd /data1/atlas/work/testarea/12.0.8/ . ...

Еще в разделе: (Показать все результаты (>5) - lhe.sinp.msu.ru/ )

... S. DNEPRO V SKII The enhancement of both the binding energy and the oscillator strength of excitons in nanostructures and the possibility to increase the strength of Coulomb interaction, responsible for the binding of electron­hole pairs to excitons, by combining semiconductor and dielectric materials with different values of dielectric constants allow to create excitonic devices operating at room temperature. , , ­ , , . ... GaAs Eex 4,2 , aex 15 . ... d aex), E 2D n R p 1 GaAlAs n 2 h - + GaAs i ....

Еще в разделе: (Показать все результаты (>27) - scon155.phys.msu.su/ )

trendence Graduate Barometer Europe 2011 About the survey ­ About trendence trendence Graduate Barometer Europe is an annual online student survey which allows students to express their opinion on topics re lated to career and education. ... Ulrike Heyne Project Manager trendence Graduate Barometer Europe 2011 About the survey Facts and benefits How does it work? ... If your students take part in the trendence Graduate Barometer, they will receive an exclusive Student Report. ...