... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>3) - iconolat13.phys.msu.ru/ )

... Individual SELEX products, aptamers, are small molecules (40­100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/febsz.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf
• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf

... Новости . О МЛЦ МГУ . ... Заявки до 25 октября 2015г. Семинар МЛЦ и кафедры . 23.03.2016 . ... Главная Новости Семинар МЛЦ и кафедры . ... квантовому перепутыванию (quantum entanglement), нарушению соотношений Белла, лазерному охлаждению . ... From Einstein s intuition to quantum bits: a new quantum age? ... Based on that concept, a new field of research has emerged, quantum information, where one uses quantum bits, the so-called 'qubits'. ... 2016 Семинар кафедры ОФиВП и МЛЦ . ...

Еще в разделе: (Показать все результаты (>23) - ilc.phys.msu.ru/ )

• "Lasers and nonlinear optics" practical course laboratory
• SpexFluorolog-3
• Setup for material analysis by laser ablation spectroscopy

... ZOO is a flexible and powerful content application builder to manage your content. ... ZOO moves from simply being a CCK to an Application Builder. Apps are extensions for ZOO which are optimized for different purposes and types of content catalogs. ... A flexible and powerful content application builder to manage your content. Download ZOO . ... escort beylikduzu bayan escort escort bayan escort escort istanbul escort bayan porno film escort istanbul escort beylikduzu escort bayan ...

Еще в разделе: (Показать все результаты (>2) - physcontrol.phys.msu.ru/ )

HERMITE FUNCTIONS EXPANSION BASED NON-LOCAL MEANS ALGORITHM FOR CT-APPLICATIONS1 N. Mamaev2, A. Lukin3, D. Yurin4, M. Glazkova5, V. Sinitsin6 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia mamaev.nikolay93@mail.ru, 3lukin@ixbt.com, 4yurin@cs.msu.ru 5,6 Federal Center of Medicine and Rehabilitation Ivan'kovskoye sh., ... Noise in CT-images is close to Gaussian [3]. ...

Еще в разделе: (Показать все результаты (>2) - imaging.cs.msu.ru/ )

... K. Krylov . There was undertaken a research of lengthes of marinon - some integral units obtained by segmenting of comleted (whole) fiction prosaic texts (stories, small novels, novels). ... Overall corpus of considereded texts (Russian fiction prosaic) contain more than two million of graphic running words. Undertaken research has lead us to revealing of three main regularities. 1) to formulation of the law of optimum relation between number of elements within each submicroscopic level; . ...

Еще в разделе: (Показать все результаты (>27) - old.philol.msu.ru/ )

... 001.89:004 .. , .. , .. , .. , .. , .., .. e-mail: kryukov@theory.sinp.msu.ru RESTFUL-- 2012-4/882 RESTful-- , : , , , UNIDATA Common Data Model, , , , , , . ... NCEP/NCAR [1], , ). , . ... RESTful-- , : , , , UNIDATA Common Data Model [2], , , , , , . ... UNIDATA Common Data Model (CDM) [2]. ... UNIDATA CDM 3. ... XML . ... Unidata Common Data Model. : http://www.unidata.ucar.edu/software/netcdf-java/CDM/ [3]. ... Network Common Data Form (NetCDF). : http://www.unidata.ucar.edu/software/netcdf/ [5]...

Еще в разделе: (Показать все результаты (>2) - sinp.msu.ru/ )

The use of the external module Ab_An.dll Ab_An.dll file is an external module for the Gibbs program, and is designed to calculate the activity coefficients of the components of albite- anortite solid solution. ... A non-ideal model of albite-anortite solid solution, proposed in literature [1], is used in this module. ... Preparation of the System file To be able to use the module Ab_An.dll, you need to include a binary solid solution of albite and anortite into the System file, as you create it. ...

Еще в разделе: (Показать все результаты (>31) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/Electrum.doc
• Faculty of geology Moscow State Lomonosov University
• Software for resistivity and induced polarization

... Форумы > Аспирантура > Тема . ... PhD позиция в Гренобле, Франция . Горячая PhD-позиция на альпийском курорте во Франции!! ... Шлите резюме на stephane.redon_at_inria.fr, s.grudinin_at_fz-juelich.de . ... Title: Generalized Adaptive Molecular Dynamics . ... One way to understand molecular mechanisms is through modeling and simulation. ... We now want to generalize the adaptive simulation theory. ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>18) - www.mmonline.ru/ )

О факультете . ... Психологи МГУ . ... Every time you come to the Library you are required to give your ID (identity card, library pass or students card) to the person on duty (attendant-adviser) . Only the attendant-adviser or the consultant is allowed to search for, select and give the books. If allowed by consultant the reader may search for the needed book independently . ... Only Library's literature may be copied and using only the hardware available in the premises of the Library . ...

Еще в разделе: (Показать все результаты (>113) - www.psy.msu.ru/ )

Mathematical modeling of biophysical processes in living cells and tissues . duration 6 months . ... 7(095) 939-26-12, Fax: +7(095)939-31-13, Email: romanov@yumr.phys.msu.ru . ... Interaction of femtosecond laser pulses with plasmas of modified targets . ... Theoretical investigations of polarization self-action and wave-interaction effects in nonlinear optics. ... Alexander V. Priezzhev, Associate Professor, Candidate of Sciences (physics and mathematics), Tel. ...

Еще в разделе: (Показать все результаты (>10) - foroff.phys.msu.ru/ )

Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Moscow, 2008 Acknowledgements A.Belinskiy M.Kornilov A.Tokovinin M.Kuznetsov P.Kortunov E.Gorbovskoy SAI administration some SAI students Pulkovo solar station (KHSS) staff RFBR support MAVEG Gmbh Why to study optical turbulence and some other relevant ... Mean seeing by DIMM data for this night is 1''5. ...

Еще в разделе: (Показать все результаты (>14) - curl.sai.msu.ru/ )

... Physical Geography and Landscape Science . ... Research laboratories . ... Annually, the researches of the Faculty publish about 40 text-books and about 30 scientific monographs and collected papers, 600 700 scientific reviewed papers also in World leading scientific journals. 7-volumes fundamental work Geography, Society and Environment was published to the 250-years anniversary of the Moscow State University. 4-volumes monograph Recent global changes of the natural environment was finalized in...

Еще в разделе: (Показать все результаты (>18) - eng.geogr.msu.ru/ )

arXiv:submit/0064778 [math.AT] 24 Jun 2010 Transitive Lie algebroids - categorical point of view A.S.Mishchenko Moscow State University Intro duction Transitive Lie algebroids have specific properties that allow to lo ok at the transitive Lie algebroid as an element of the ob ject of a homotopy functor. Roughly speaking each transitive Lie algebroids can be described as a vector bundle over the tangent bundle of the manifold which is endowed with additional structures. ...

Еще в разделе: (Показать все результаты (>53) - higeom.math.msu.su/ )

• http://higeom.math.msu.su/people/taras/talks/2013novosibirskGD-talk.pdf
• http://higeom.math.msu.su/people/taras/talks/2013tianjin-talk.pdf
• http://higeom.math.msu.su/people/taras/mypapers/umn-s00e.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

TUS/KLYPVE Program for Observation of Extreme Energy Cosmic Rays from Space B.A. Khrenov DV Skobeltsyn Institute of Nuclear Physics of MV Lomonosov Moscow State University Workshop "Cosmic Ray Large Scale Experiments in the Second Decade of the 21st Century" 17 May 2011 TUS/KLYPVE collaboration SINP MSU, JINR (Dubna), RSC "Energia", Consortium "Space Regatta" EWHA University (Seoul, Korea) Puebla University (Mexico) Universities of Japan, RIKEN (Tokyo). ... Digital oscilloscopes for UV flashes. ...

137. VaST homepage

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда