W elcome to LHE guests page . ... 1) Enter metro station, buy a metro ticket in the ticket-office if You have not it yet. ... You will find a table with the prices near the ticket-office. ... 1) Buy a bus ticket in a kiosk near the bus stop if You have not it yet. ... It is possible to buy a ticket for 1 trip from the bus driver (28 rub). 2) Enter a bus through the front door, stick your ticket into a machine near the turnstile and take it. ... You can find more information on this site . ...

Еще в разделе: (Показать все результаты (>15) - lhe.sinp.msu.ru/ )

• LHPR Homepage
• Atlas
• STUDENT invitation

... Research . ... 1972 – current: Moscow State University . ... In 1989 she took her doctor's degree in linguistics (kandidat filologicheskikh nauk) at Lomonosov Moscow State University for the thesis "Computer data bases of the Selkup language: creation and use in linguistic research (Mashinnyi fond selkupskogo yazyka: sozdaniye i ispol’zovaniye v konkretnykh lingvisticheskikh issledovaniyakh)”. ... Documentation of and research into endangered languages presupposes linguistic fieldwork . ...

Еще в разделе: (Показать все результаты (>38) - lcl.srcc.msu.ru/ )

... Department of Computational mathematics and cybernetics , Lomonosov Moscow State University . ... Thesis title "Machine learning approach for automatic performance tuning of parallel program", supervisor Dr. Nina N. Popova. ... High-performance computing, automatic performance tuning, machine learning algorithms, evolutionary and bio-inspired programming, parallel algorithms in VLSI design . ... Algorithms and framework for automatic selection and tuning parameters of parallel sparse linear solvers....

Еще в разделе: (Показать все результаты (>3) - angel.cmc.msu.ru/ )

The Day the World Changed Vocabulary Expressions I Task1. ... Nazi war criminals committed appalling atrocities during World War II. 2.debris ­ a quality of being well known for evil, esp. morally wicked actions. After the bombing there was a lot of debris everywhere. 3.resolve ­ an act of great evil, esp. cruelty, shocking, terrible. ... He didn't seem daunted by the difficulties facing him. 9.infamy ­ smth that needs attention, consideration, service, being more important than anything else. ...

Еще в разделе: (Показать все результаты (>25) - www.eng.math.msu.su/ )

... Practice of Business The course provides students with practical working experience in companies operating in various areas of business, including finance, communications, consultancies, natural resource management, high-tech and others. ... The course includes writing an industry-specific group report. ... Human resources management (international aspects) The course will provide a basic introduction to the organization of international human resources in business. ...

Еще в разделе: (Показать все результаты (>116) - www.mgubs.ru/ )

• Выпуск 2/2011 | Высшая школа бизнеса МГУ им. Ломоносова
• Высшая школа бизнеса МГУ им. Ломоносова

... About Us . ... Symbols of the Faculty . ... Students . ... The English Language Department for Science Faculties . ... The English Language Department for Science Faculties has been part of the Faculty of Foreign Languages and Area Studies since I988 when the latter was established. ... However, professional interests of many members of the Department extend far beyond teaching English to science students the teachers also support other projects of the Faculty of Foreign Languages and Area Studies. ...

Еще в разделе: (Показать все результаты (>151) - ffl.msu.ru/ )

• International Students

... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>17) - pk.math.msu.ru/ )

• information | Mechmath admission for internetional students
• IX Festival of Science | Mechmath admission for internetional students

Book Review Struct Multidisc Optim 28, 372 ­ 373 (2004) DOI 10.1007/s00158-004-0451-7 A.P. Seyranian and A.A. Mailybaev: "Multiparameter Stability Theory with Mechanical Applications" World Scientific Publishing Co. ... A remarkable feature of the book is the authors' presentation of a new multiparameter bifurcation theory of eigenvalues, which is a key point for the stability and instability studies. ... The material of the book is organized into 12 chapters. ...

Еще в разделе: (Показать все результаты (>32) - mailybaev.imec.msu.ru/ )

• Book review by Professor Teodor M. Atanackovic
• Multiparameter Stability Theory with Mechanical Applications

... Paradigm shifts by Kuhn: successive change of one model by another, rather than integration of different paradigms Progress of science: from single- to multi-model approach Some examples from natural science... · theory of light: from vibration of ether to wave-particle duality · laws of motion: from Newton's dynamics to SchrЖdinger 's and Heisenberg's formalism In social and environmental sciences appreciation of the multi-model ...

Еще в разделе: (Показать все результаты (>6) - oc.cs.msu.ru/ )

• http://oc.cs.msu.ru/eroven/page.htm
• CURRICULUM VITAE

... OLIVER GRAYDON QUANTUM OPTICS The quest for higher dimensionality Using a clever design of polarization optic, Italian researchers have successfully created four-level `ququart' quantum states using the polarization and orbital angular momentum of single photons. ... In recent years it has become popular to use states that have definite values of orbital angular momentum (OAM) as qudits1. ... L|-2o + |R|+2o)/2 where the and o subscripts denote polarization and OAM states, respectively. ...

Еще в разделе: (Показать все результаты (>107) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2006-prl-97-023602.pdf
• Sergei Kulik: List of major publications
• Directions :: Quantum Information Laboratory

... RIZNICHENKO and T. Yu, PLYUSNINA Biology Faculty of the Lomonosov State University (Received 29 September 1994) The model of transmembrane ion transfer is employed to demonstrate the possibility, in principle, of a non-linearly organized biological system to respond to weak low-frequency electromagnetic radiations (10 Vim, 0.1-100 Hz). The interaction of the biological system of ion transfer with an external electromagnetic field leads to bifurcational changes in the system. ...

Еще в разделе: (Показать все результаты (>41) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3344.pdf
• http://library.biophys.msu.ru/PDF/3333.pdf
• http://library.biophys.msu.ru/PDF/3343.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Nhunt

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>135) - bioinf.fbb.msu.ru/ )

• SDPlight

... NetCDF User's Guide for C . ... more standard error behavior, by uniformly communicating an error status back to the calling program in the return value of each function. ... We are hoping that the benefits of the new interface will be an incentive to use it in new netCDF applications. ... The new interface handles errors differently than netCDF-2. ... Where the netCDF-2 interface used NC_LONG to identify an external data type corresponding to 32-bit integers, the new interface uses NC_INT instead. ...

Еще в разделе: (Показать все результаты (>56) - angel.cs.msu.su/ )

• Index
• PhD Summer School on Scentific Computing

The head of the team - Vladimir A.Veselovsky , Professor of Biophysics . ... M.V.Lomonosov State University, Moscow, Russia . ... Induced by different factors (light, H 2 O 2 , KMnO 4 , electric current etc.) luminescence of roots and leaves was used for investigation of mechanisms of damage in cells and for plant resistance determination. ... Moscow. Znanie (in Russian). 1964. 48 p. Tarusov B.N., Veselovsky V.A. Ultra Weak Light Emission of Plant and its Practical Significance. ...

Еще в разделе: (Показать все результаты (>15) - www.biophys.msu.ru/ )

• Chlorophyll Fluorescence in vivo: A Theory
• Как отмечалось выше, обилие (по Fo) и фотосинтетическая активность

... MSU Chamber Orchestra . ... Concerto МГУ . ... music of XVI - XVIII cc. ... Natalia AZARKINA, Alexander KONSTANTINOV, Olga ZHUKOVA (violins) . ... Metro station "Riazanskij prospekt", "Vyhino"; buses 208, 133 . ... Alexander Konstantinov, music director . ... Sarra - Galina ZHUKOVSKAYA (soprano) . ... Olga NAZAIKINSKAYA (soprano) . ... Alexander KONSTANTINOV, Olga ZHUKOVA (violins) . ... Vladimir DROZDOV ( viola da gamba) . ... Olga ZHUKOVA, Alexander KONSTANTINOV . ... Olga NAZAJKINSKAJA soprano . ...

Еще в разделе: (Показать все результаты (>5) - music.genebee.msu.su/ )

• MSU Chamber Orchestra. Concerts. Season 1999/2000.
• MSU Chamber Orchestra. Concerts. Season 2001/2002.
• MSU Chamber Orchestra. Concerts. Season 2000/2001.

... Physical Chemistry Division , . ... Khrenova M. Andrijchenko N. Grigorenko B. Nemukhin A. Minimum energy reaction profiles for the hydrolysis reaction of the cyclic guanosine monophosphate in water: Comparison of the results of two QM/MM approaches . ... Savitsky A.P. Rusanov A.L. Zherdeva V.V. Gorodnicheva T.V. Khrenova M.G. Nemukhin A.V. FLIM-FRET imaging of caspase-3 activity in live cells using pair of red fluorescent proteins . ... Khrenova M.G. Nemukhin A.V. Grigorenko B.L. Krylov A.I . ...

Еще в разделе: (Показать все результаты (>21) - lcc.chem.msu.ru/ )

• Laboratory of Chemical Cybernetics

A GENETIC ALGORHYTM FOR OPTIMIZING A NEURAL NETWORK CAPABLE TO LEARN FOR FOOD SEARCHING IN A RADIAL MAZE Budilova E.V., Chepurnova N.E., Chepurnov S.A, Teriokhin A.T. M.V.Lomonosov Moscow State University, Dept. of Biology. ... The upper platform has a hole in the middle and several radially directed tubular canals ("arms") each of which can contain a peace of food and has doors opening only in the centrifugal direction. ... The task of the animal is to visit only those arms which contain food. ...

Еще в разделе: (Показать все результаты (>40) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf

... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>10) - biophys.msu.ru/ )

• C U R R I C U L U M V I T A E
• CURRICULUM VITA
• CURRICULUM VITAE

Dear friends, It is less than three weeks left till the 39th IChO starts. ... Currency and cards. Russian rouble is the only currency accepted throughout Russia. ... To attention of Head mentors intending to pay fees on arrival in cash: payments will be accepted in Russian roubles only. ... During the IChO, mentors and guests will stay in Holiday Inn Sokolniki, and students in the Olympian camp, which is also an option for early arrivals and late departures. ... The 39th IChO Organizing Committee ...

Еще в разделе: (Показать все результаты (>3) - icho39.chem.msu.ru/ )

• http://www.icho39.chem.msu.ru/