... Geography of World Economy . ... Recreational Geography and International Tourism . ... Departments . ... Field training . ... The department curriculum is focused on preparation of experts of the top skills in the field of tourist business, tourist service, the government in tourism sphere. ... A theme of scientific work of department Territorial touristic-recreational systems: natural and social and economic preconditions of a sustainable development includes three underthemes. ...

Еще в разделе: (Показать все результаты (>38) - eng.geogr.msu.ru/ )

... News . ... Create new account (active tab) . ... Request new password . ... E-mail address * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Group - None - 217 (2016 пЕпѕпґ) 219 (2016 пЕпѕпґ) 217 (2015 пЕпѕпґ) 215 (2015 пЕпѕпґ) 217 (2014 пЕпѕпґ) 215 (2014 пЕпѕпґ) 315 316 219 218 117 CAPTCHA . ...

Еще в разделе: (Показать все результаты (>195) - nanolab.phys.msu.ru/ )

• User account | Лаборатория нанооптики и метаматериалов
• Contact khokhlova | Laboratory of Nanophotonics & Metamaterials
• Maxim Shcherbakov in the media | Laboratory of Nanophotonics & Metamaterials

University Satellites and . Space Science Education . ... Use of microsatellite technology in aerospace education by the example of BAUMANETS microsatellite project . ... Launch is scheduled for March 2006. ... Over 20 students graduated from BMSTU and found work in leading Russia s and international aerospace companies. ... Meanwhile, modern labor market in aerospace shows increasing requirements towards quality of university education. ...

Еще в разделе: (Показать все результаты (>30) - cosmos.msu.ru/ )

Particle pair production in strong EM field, Imaginary temperature and field emission Boris Levchenko SINP MSU, Moscow Tunneling processes (Nature, adv. technologies) Electron field emission from metals: quantum theory by Fowler and Nordheim Results by Sauter and Schwinger for electric field in vacuum Condensed matter .vs. ... QFTHEP'10, BB Levchenko Pair production 16 Scheme of probing strong-field QED in the collisions of a 50-GeV electron beam with a focused laser beam. ...

Еще в разделе: (Показать все результаты (>88) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/POZDEEVAQFTHEP13.pdf
• http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf

... Site is discontinually updating by professional biologists and students of biology faculty of MSU. ... Journals began from 'J' . ... Elsevier Science ] . biology . ... Kluwer Academic Publishers ] . ... American Physiological Soc... ] . ... Wiley Interscience ] . ... Journal of Biochemistry and Molecular Biology . ... Journal of Biochemistry, Molecular Biology and Biophysics . ... Journal of Bioinformatics and Computational Biology . ... Journal of Biology . ... JCatalog | Journal list . ...

Еще в разделе: (Показать все результаты (>185) - journals.genebee.msu.ru/ )

• JCatalog - Science Magazines Catalog

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI « » - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>3) - angel.cmc.msu.ru/ )

... It has been shown [1], that in some cases, in chaos set A the sub-set B can exist, in which the chaos behavior can be stabilized by external parametrical perturbations. ... As the first step I've found the A set (the set of chaotic behavior) and as a second step, by using different parameters combination (that can be consider as parameter perturbations of the system) I've found the B set (the set, where some stable cycles exists). ... For the f(x)=ax(1-x) map this is [3,8 4,0] interval. ...

Еще в разделе: (Показать все результаты (>58) - chaos.phys.msu.ru/ )

Host: localhost Database: atomax2 --------------------------------------------------------- -- Server version 3.23.52-nt -- -- Table structure for table ' deliveries ' -- DROP TABLE IF EXISTS deliveries ; CREATE TABLE deliveries ( id_delivery int (11) NOT NULL auto_increment, subj varchar( 255 ) default NULL , author varchar( 255 ) default NULL , type tinyint (4) default ...

Еще в разделе: (Показать все результаты (>7) - textbook.sinp.msu.ru/ )

• http://textbook.sinp.msu.ru/modules/ax_visitors/visitors.mysql
• http://textbook.sinp.msu.ru/modules/ax_visitors/visitors.sql
• SPAW Editor documentation

... Laboratory "Сryoelectronics" . Currently our group is working atљ experimental љstudying of nanoelectronic devices based on silicon, mostlyљsilicon nanowires and single-electron transistors. ... Suspended single-electron transistor made up from highly doped silicon on insulator (Laboratory of Cryoelectronics 2012)љ . ... E: This email address is being protected from spambots. You need JavaScript enabled to view it. P: +7 (495) 939-39-87 . ... 2016 Laboratory "Сryoelectronics" ...

Еще в разделе: (Показать все результаты (>9) - cryolab.phys.msu.ru/ )

• Molecular single-electronics
• Alexandr A. Parshintsev

About BAFIZ . BAFIZ at SINP MSU . ... The main aims of the Project at SINP of MSU . ... Development of the Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE) at SINP of MSU . Development of the tools for Space Physics data utilization and processing . ... The communication infrastructure base of the Project at SINP of MSU is based on Radio-MSU Network . The computational base of the Project at SINP of MSU is Computing Center ALPHA . ...

Еще в разделе: (Показать все результаты (>18) - dbserv.sinp.msu.ru/ )

• Satellite Informations Sector
• ULYSSES Online Data Set Selector

Sign in Register . ... Resources . ... Forums . ... 495) 3334-65-56 . info@ecfs.msu.ru . All contacts . ... Home Forum . ... Search in section Everywhere Основная дискуссия -Ongoing consultations/ Текущие онлайн конференции -Прошедшие онлайн конференции -Общая дискуссия -Евразийское почвенное партнерство . ... Основная дискуссия . Ongoing consultations/ Текущие онлайн конференции . ... Прошедшие онлайн конференции . ... Общая дискуссия . ... The Department of land resources . ... Forum . ...

Еще в разделе: (Показать все результаты (>20) - ecfs.msu.ru/ )

• Ongoing consultations/ Текущие онлайн конференции | ECFS
• About Eurasian Center for Food Security | ECFS

. Veronika K. Laurinavichyute . /Lunina/ . Senior Scientific Researcher, PhD . CV . Selected Publications . News: . 12.08.2013. - Page updated 20.07.2013. - Project GRAVITSAPA started 01.07.2013. - Published: Practical exercises in physical chemistry. MGPU. Part 2. 2013 16-21.06.2013. - Workshop on composite materials, Harbin 10.04.2013. - On-line publication: Electrochimica Acta (2013), pp. 102-107 23.03.2012. - Website created! . nika@elch.chem.msu.ru . +7(495)939-1321 . Back

Еще в разделе: (Показать все результаты (>44) - electr003.chem.msu.ru/ )

Open Conference Systems . Conference Help . ... Username . Password . Remember me . ... Conference Content Search . All Authors Title Abstract Index terms Full Text . ... By Conference . By Author . By Title . ... For Authors . Home . ... Log In . Account . Search . Current Conferences . Home > Log In . ... Remember my username and password . ... Create an account with this site . Forgot your password? ...

Еще в разделе: (Показать все результаты (>45) - hea.phys.msu.su/ )

• Account

. Russian Version . Faculty of Computational Mathematics and Cybernetics . The Department of Operations Research . About Us . News . ORM2016: actual announcement and abstract templates . Archive of . Conferences ORM . Study . Undergraduates . Postgraduate education . Bachelor Program . Master Program . Faculty . Lecture . notes . Contacts . Graduates . New . publications . Create Date : 23.05.05 . The Department of Operations Research

Еще в разделе: (Показать все результаты (>17) - io.cmc.msu.ru/ )

• Кафедра Исследования Операций

... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . Final program Accommodation Program committee Organizing committee . ... V Moscow International Conference . on Operations Research, . ... Moscow, April 10-14, 2007 Final program . ...

Еще в разделе: (Показать все результаты (>10) - io.cs.msu.ru/ )

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... Please enter your username or email address. You will receive a link to create a new password via email. Username or E-mail: . ... Password . ... Lost Password . ...

Еще в разделе: (Показать все результаты (>38) - lomonosov.sinp.msu.ru/ )

... About 70 scientific papers. The theory of square parachute is created, describing distribution of parameters of shape, tension and resistance to airflow of canopy in steady-state condition for various sets of suspension line lengths and air-permeability. ... The practical recommendations for optimal parachute application are submitted. ... It is discovered experimentally that a character of pressure distribution for a square canopy depends on a particular choice of suspension line lengths. ...

Еще в разделе: (Показать все результаты (>3) - margaret.imec.msu.ru/ )

• teachers

... about ERC . education . research . events . ... Being an effective way of acquiring knowledge, they also make a good addition to core lecture courses and involve students, postgraduates and scientists of other Russian higher education institutions and research centers in ERC activity in the initial stage. ... More information can be found at http://polly.phys.msu.ru/ru/unc/sconf.html . ... Conference on Development Prospects of Education and Research Centers in the Russian Federation . ...

Еще в разделе: (Показать все результаты (>13) - nano.msu.ru/ )

... Nonlinear spectroscopy . Nonlinear fiber optics . Attosecond optics . ... qqqqqqqqqqqq Rapidly progressing fiber-optic technologies open new avenues in biophotonics, providing an advanced platform for the creation of novel fiber-based imaging systems optical endoscopes, biophotonics-oriented fiber laser sources and optical neural interfaces. ... Как правило более точные методы регистрации ионных токов (с помощью электродов) сильнее ограничены по числу одновременно регистрируемых нейронов. ...

Еще в разделе: (Показать все результаты (>2) - photonicslab.phys.msu.ru/ )