... Furman and A.V.Tikhonravov, "Basics of optics of multilayer systems" , Editions Frontiers, Gif-sur Yvette, 1992, 242 p. A.V. Tikhonravov, M.K. Trubetskov, I.V. Zuev and P.G. Verly, "Efficient Refinement of Inhomogeneous Optical Coatings", in "Optical Interference Coatings", OSA Technical Digest Series, vol. ... A.V. Tikhonravov, M.V. Klibanov, I.V. Zuev, "Numerical study of the phaseless inverse scattering problem in thin film optics", Inverse problems, 1995, Vol. 11, pp. ... Основные публикации . ...

Еще в разделе: (Показать все результаты (>28) - www.srcc.msu.ru/ )

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>170) - www.pereplet.ru/ )

• News of Russian Science

Paleopedology is regarded as the study of paleosols, which have in turn been somewhat loosely defined as soils "formed on a landscape during the geologic past" (Ruhe 1956; Yaalon 1971) We distinguish buried paleosols (fossil soils) from non-buried paleosols (relict soils or relict paleosols). ... Non-buried paleosols (relict soils) do not suffer from these difficulties but there are even more problems of defining and recognizing them. ... 1995). ... Bronger, A. et al. 1995 in. ...

Еще в разделе: (Показать все результаты (>172) - www.fadr.msu.ru/ )

• A LITTLE COMMENT to the Commentary about Soils, Paleosols and Geosols by Vance
• IV International Conference on Cryopedology
• Proposition

... Студенческая Астрономическая обсерватория ГАИШ . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... For those really interested in galaxies, extragalactic astronomy or the aspects of cosmology we study, we can always find an interesting problem to work on. ... To make your work in the Group most effective, it would be useful to study the following courses read by our group members as well as the members of other groups in our and other institures. ... Student information . ...

Еще в разделе: (Показать все результаты (>15) - www.sai.msu.ru/ )

... Кафедра нелинейных динамических систем . ... В понедельник, 11 апреля 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Автор: Фурсов Андрей Серафимович 09.04.2016 . В понедельник, 28 марта 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Сотрудники кафедры НДСиПУ, участвующие в 2016 г. в экзаменационной комиссии - Боресков А.В., Краев А.В., Бобылева О.Н., Гончаров О.И., Капалин И.В. Автор: Фурсов Андрей Серафимович 22.02.2016 . ...

Еще в разделе: (Показать все результаты (>15) - ndsipu.cmc.msu.ru/ )

Lessons learned from the Thirty Meter Telescope site testing Tony Travouillon Sebastian Els, Angel Otarola, Reed Riddle, Matthias Schoeck, Warren Skidmore TMT.XXX.PRE.05.0XX.DRF01 1 Introduction TMT and its Site testing. Important choice before going on site. ... Considerations during analysis of the data. TMT.XXX.PRE.05.0XX.DRF01 2 Some Background about the TMT Site Testing TMT is a 30m, segmented, RitcheyChretien telescope design. ... ASCA Cloud Cover Analysis So how do we do it in practice? ...

Еще в разделе: (Показать все результаты (>21) - site2010.sai.msu.ru/ )

• http://site2010.sai.msu.ru/static/doc/GHerriot_site2010.ppt.pdf

... 2 Telescop e finder Do not rely on that the nominal alignment of coordinate system Auto Alignment made on stars will serve a long time. ... The Meade telesc tages: 1) there is no possibility to common error in the telescope soft system, when telescope moving in ope parking using command :hP# has the following disadvanobtain information on the completion of this procedure, 2) a often leads to tripping-over a limiter and to loss of coordinate a horizontal coordinate system. ... Home Position. ...

Еще в разделе: (Показать все результаты (>23) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/infrasoft_eng.pdf
• http://curl.sai.msu.ru/mass/download/doc/sv_ug.pdf
• http://curl.sai.msu.ru/mass/download/doc/dimm_soft_description.pdf

Anisotropy of Cosmic Rays. Origins, experiments, data analysis problems & methods. ... ANTARES problems and methods. ... 2D» experiments Name Tibet Air Shower Array Position 90.522o E, 30.102o N; 4300 m above sea level 30.11 N, 4300m a.s.l. Gran Sasso, 2000m Caucasus, 1700m (40deg N, 113 deg W), atmospheric depth of 860 gm/cm2 Energy 4,6.2,12,50, 300 TeV Gamma /CR mix Time 1997-1999 TibetII, 1999-2001 TibetIII (bigger HD array). 4 years 1 year Statistics 7x109 in ~1000 days Rate Ang. ...

Еще в разделе: (Показать все результаты (>22) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/seminar/Kulikovskiy.pdf
• http://antares.sinp.msu.ru/docs/Shirokov%20-%20The%20first%20results%20of%20MSU%20groups%20in%20ANTARES%20project.pdf

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>5) - compmech.math.msu.su/ )

• Список публикаций - А. Н. Козлова - Кафедра вычислительной механики

University Satellites and . Space Science Education . ... A SERIES OF ATLASES ON METHODS OF SPACE IMAGES INTERPRETATION AS A NEW TOOL FOR REMOTE SENSING EDUCATION IN EARTH SCIENCES . ... Special manuals in the form of atlases of satellite images and their interpretation results are within the best tools for support of the geographical and ecological research and thematic mapping. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>86) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University
• UNIVERSAT-2009: University Satellites in Space Sciences Education, Zvenigorod,

... Michail A. Ormont Research activity of the group is related to the theory of transport and optical properties of disordered semiconductors, in particular, the disorder effects in systems of reduced dimensionality. Studies of phonon-assisted hopping transport include the theory of hopping in quasi-one- and quasi-two-dimensional systems and hopping thermoelectric effects. ... Anisotropy in hopping conductivity of quasi-one-dimensional systems. ... Electronic Superstructures in Doped Superlattices. ...

Еще в разделе: (Показать все результаты (>50) - scon155.phys.msu.su/ )

• Conduction in Granular Metals: Virtual State-Assisted Hopping
• Photoelectric phenomena and metastable states in amorphous semiconductors

Elements of the theory of the time resolution spectra and photo-induced chemical processes. Gribov L.A. Institute of Geological Chemistry, Moscow, Russia What we see in spectra and what we need? Experiments and models. The connection between them is the reflection of model characteristics on the class of measurable quantities: positions of spectral bands and lines. Inverse problems. Models ambiguity. Luminescence time resolution. Modern design methods (modern methods of calculation). Quantum beatings. 19

Еще в разделе: (Показать все результаты (>65) - www.msm.biophys.msu.ru/ )

• MSM 2007

... Описание вакансии: . We are currently looking for a Chemistry Laboratory Manager full time position located in Georgia: . ... Ю Organize the conducting of chemical analysis and lab researches in order to perform lab control for ensure the conformity with international and local standards and technical conditions; . ... Ю Control proper filling of lab registers and timely reporting of lab analysis results in order to submit them for further processing and transfer to Client. ... добавить вакансию . ...

Еще в разделе: (Показать все результаты (>38) - www.chemport.ru/ )

• "Phd student position in chemical biology and molecular imaging" - вакансия в
• Fundamentals of Bioorganic Chemistry. Textbook for medical students /
• "Аналитик-исследователь" - вакансия в разделе "Работа для химиков" @ChemPort.Ru

... The technique had been developed for calculating destruction of melting vitreous bodies in hypersonic gas flows taking into account the internal radiative transfer. ... The problem of flow in the chemically non-equilibrium boundary layer at a stagnation point of blunt body had been solved by the asymptotic method and formulas for the heat and diffusion fluxes to a surface of any catalycity had been obtained. ...

Еще в разделе: (Показать все результаты (>7) - lab106.imec.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

NPAE 2012 4-th International Conference Current Problems in Nuclear Physics and Atomic Energy (NPAE-Kyiv2012) September 10 - 14, 2012 Kyiv, Ukraine Dear colleagues, This is the first circular of the 4-th International Conference on Current Problems in Nuclear Physics and Atomic Energy (NPAE-Kyiv2012), which will be held from September 10 to September 14, 2012 in Kyiv, Ukraine. ... 36, Kyiv), near Metro station Vasylkivska. ... Conference fee and registration Registration fee for participants 250 Euro. ...

Еще в разделе: (Показать все результаты (>176) - phys.msu.ru/ )

• http://phys.msu.su/rus/news/latest/programme_lectures_MSU_Farle_2014.pdf
• http://phys.msu.su/upload/iblock/b4b/Announce-3.doc
• http://phys.msu.su/rus/news/latest/poster.pdf

Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...

Еще в разделе: (Показать все результаты (>7) - www.fbm.msu.ru/ )

Service . Analytical Laboratory Provides Service In The Field Of . Applied Statistics. Training in applied statistics and in statistical software tools usage. Formalization of practical problems and solution algorithms choosing. Applied statistical problems solving, using Your data. ... Consultations on choosing of Russian and American software tools for applied statistical problems. Phone/Fax: (095) 939-5306 . e-mail: makarov@makarov.msu.ru . ... Fax . ... InCo . ...

Еще в разделе: (Показать все результаты (>4) - statsoft.msu.ru/ )

• InCo literature in English

A full system of equilibrium differential equations for the finite number of suspension lines (n = 28) of square parachute is derived. ... One can determine the shapes of inflated canopy radial cross-sections, stress distribution of radial ribbons on the canopy surface and fabric stress between them, drag coefficients for various line lengths and air-permeability by means of computer simulation. ... Initially, this problem was solved assuming D p = const over total canopy of square parachute. ...

Еще в разделе: (Показать все результаты (>6) - margaret.imec.msu.ru/ )

• Large-Scale Load Stabilization

МГУ имени М.В.Ломоносова Русская версия . ... Science calendar . ... Innovative natural resources management . ... Art Criticism and History . ... International Conference for Students and Young Scientists "Lomonosov" . ... 29 Feb 2016 . ... The members of C ouncil of experts : Bobyleva A.Z., Doctor of Economics, Professor; Volcov F.M., Doctor of Economics, Professor; Klementyev D.S., Doctor of Philosophy science, Professor; Koshkidko V . ... The history of management . ... МГУ имени М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>82) - conf.msu.ru/ )