The laboratory runs currently several scientific projects aimed at the foundations of quantum information science (the theories of quantum measurement and entanglement, design and analysis of quantum cryptographic protocols, atoms dynamics in optical dipole trap, etc.), applications of quantum theory to modeling quantum interference phenomena in multilevel atoms interacting with optical and magnetic fields (dark resonance spectroscopy), and exploring ... Physics 96 (4), 629-642 (2003). ...

Еще в разделе: (Показать все результаты (>76) - qilab.phys.msu.ru/ )

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>3) - www.edst.msu.ru/ )

• http://www.edst.msu.ru/conf/docs/Bologne.doc

... The Symposium's three breakout sessions focused on risks from different perspectives: enterprise use, resource constrained environments, and combating malicious use. ... Specifically, a DNS collaborative response, awareness, technical training, and future DNS security, stability, and resiliency collaboration should take precedence within the issues selected for further study and implementation. ... Breakout Session Overview.. ... 30 Appendix F: Combating Malicious Use Breakout Session Guide Book .. ...

Еще в разделе: (Показать все результаты (>19) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf
• Институт Проблем Информационной Безопасности

The Department of Talented Youth Affairs and Professional Orientation . ... The Faculty of Journalism of Moscow State University has announced the contest for the design creation of ?Space University? logotype and emblem. ... Criteria for the appraisal of the design: . ... Contest dates: from February 15, 2016 till May 15, 2016. For more information about the contest visit the website: www.journ.msu.ru . ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>47) - talant.msu.ru/ )

• editor | The Department of Talented Youth Affairs and Professional Orientation
• News | The Department of Talented Youth Affairs and Professional Orientation |
• admin | The Department of Talented Youth Affairs and Professional Orientation

MSU . Science Park . ... 2-4 June 2014, Moscow hosted the Third International Summit of technology parks and business incubators "Technoparks as new drivers of national economic development." ... To do this for three days at the III Summit held an educational seminar "Managing effective business incubators and technology parks" with American colleagues - Heads of existing industrial parks and technology transfer centers. ... JSC MSU Science Park. ...

Еще в разделе: (Показать все результаты (>13) - www.sciencepark.ru/ )

• MSU Science Park - About us

Клуб выпускников МГУ (Московский Государственный Университет) . Эта конференция предназначена для общения выпускников МГУ проживающих и работающих в США. Добавить сообщение . ... Автор: Irina Orlova . Дата: 09.07.2007 20:36 . ... Anna Cobb forwarded your message to me suggesting that I should try and get in touch with you. ... Hello Anna, . ... Автор: Anna Kuznetsova . ... Автор: Anna Cobb . ... Anna . ... Автор: Anna Cpbb . ... Выпускник Географического ф-та МГУ 1993 года Сычев Олег. ...

Еще в разделе: (Показать все результаты (>331) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Конференция "Вакансии"
• Клуб выпускников МГУ: Кайя Кальпа: продление жизни и бессмертие
• Клуб выпускников МГУ: КИБЕРНЕТИЧЕСКАЯ ЛИЧНОСТЬ. БЕССМЕРТИЕ?

... Custom Query . ... Component . ... automata io requirements ui . ... В And В Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . Or В Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . ... Summary Component Milestone Status Owner Type Priority Resolution Created Modified Blocked By Blocking Reporter Keywords Cc . ...

Еще в разделе: (Показать все результаты (>626) - kodomo.cmm.msu.su/ )

• Custom Query ? Cyclyc Cell Automata

... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Reconstruction of a high-resolution image from a low-resolution image is a common problem in image processing. ... Reconstruction of a high-resolution image as a solution of ill-posed inverse problem to the reconstruction of a low-resolution image from high-resolution one. ... The process of recontructing a single high-resolution images from several low-resolution observations is called as superresolution. ...

Еще в разделе: (Показать все результаты (>154) - imaging.cmc.msu.ru/ )

... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...

Еще в разделе: (Показать все результаты (>48) - sn.sai.msu.ru/ )

... After strong impacts of meteorites or spacecrafts (Lunar Prospector) with the Moon's surface, the radio emissions in various frequency ranges were recorded. ... 2 Review of radio observations of the Moon The main source of lunar radio emission at centimeter wavelengths is the thermal emission of a brightness temperature equal to 250 K. The intensity of the thermal radio emission changes slowly with a period equal to one month. ... The calibration of the lunar radio flux was conducted Fig. ...

Еще в разделе: (Показать все результаты (>89) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Rod/Publications/ms40/21_Dolitsky_etal.pdf
• http://selena.sai.msu.ru/Laz/Publications/6_Automatic%20creation%20of%20the%20hypsometric%20map%20of%20Venus.pdf
• http://selena.sai.msu.ru/Laz/Publications/7_Automated%20creation%20of%20the%20lunar%20hypsometric%20map%20techniques%20of%20compiling.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>25) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Higher education institutions call on governments, in their national and European contexts, to facilitate and encourage change and to provide a framework for coordination and guidance towards convergence, and affirm their capacity and willingness to initiate and support progress within a joint endeavour q q q q q q q q q to redefine higher education and research for the whole of Europe ; to reform and rejuvenate curricula and higher ...

Еще в разделе: (Показать все результаты (>65) - www.socio.msu.ru/ )

• Вестник МГУ

Moscow Astronomical Plate Archives: . Contents, Digitization, Current and Possible Applications . ... We describe the astronomical plate archives in Moscow and Zvenigorod and the existing digitization projects. ... 2 The Plate Archive of the Sternberg Institute . The contents of the most important Moscow astronomical plate archive, that of the Sternberg Astronomical Institute, was briefly presented in Shugarov et al. [1] in 1999. ... THE MOSCOW PLATE COLLECTION (STERNBERG INSTITUTE) . ...

Еще в разделе: (Показать все результаты (>32) - www.sai.msu.ru/ )

• Digitization of Moscow Plate Archives

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: ?аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>25) - ecfs.msu.ru/ )

• International Forum on Eurasian Food Security and Nutrition Network and
• The structure of the ECFS | ECFS
• Topic 1: Building the Eurasian Food Security Network / Создание Евразийской

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... New approaches to the synthesis of hybrid materials InP - organic stabilizer . ... To replace the membranes using standard samples CT InP, myristic acid, stabilized, and samples heterostructures InP / ZnSe with two monolayers Accrued zinc selenide and also stabilized myristic acid. ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>25) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and
• Лаборатория химии и физики полупроводниковых и сенсорных материалов |

... ЭОС истфака МГУ . ... x25BA; Кафедра исторической информатики . ... Course categories: Кафедра истории средних веков Кафедра исторической информатики Кафедра исторической информатики / Практика использования ДОТ Кафедра истории России до начала XIX века Кафедра новой и новейшей истории стран Европы и Америки Кафедры этнологии Археографическая лаборатория Школа учителей истории . ... Информационные технологии и математические методы в исторических исследованиях и образовании . ... Home ...

Еще в разделе: (Показать все результаты (>4346) - www.hist.msu.ru/ )

• ЭОС истфака МГУ: Course categories
• Электронная образовательная среда исторического факультета МГУ имени
• Summary of история россии 18 века

... Professors: Corresponding member of RAS S.A.Dobrolubov (water masses, ocean and atmosphere interaction), corresponding member of RAS S.K.Gulev (ocean and atmosphere interaction), academician of RAS A.S.Sarkisian (sea currents theory); . ... Data bases have been created: for Caspian Sea hydrological and hydrochemical observations in the second half of the XX century involving more than 70 thousands of oceanologic stations; for Black Sea about 60 thousands stations with thermohaline observations. ...

Еще в разделе: (Показать все результаты (>48) - eng.geogr.msu.ru/ )

• Available cartographic data

... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1808.txt

Russian version . ... Leninskie Gory 1, Moscow, 119991, Russia . ... The title is: "The development of resonant X-ray reflectivity method near the L2,3 absorption edges for investigations of magnetic multilayers". ... Moscow. ... Russia. ... A. Smekhova, е.ю. Gan'shina, B.S. Roschin, A.D. Gribova, M.A. Andreeva, F. Wilhelm, A. Rogalev, "Structural and Magnetic Studies of [Co 0.45 Fe 0.45 Zr 0.1 /a-Si] N Multilayers", Journal of Spintronics and Magnetic Nanomaterials, 1 (1), pp.11-17 (2012) [pdf] . ...

Еще в разделе: (Показать все результаты (>17) - magn.phys.msu.ru/ )

• Сотрудники кафедры магнетизма: Ведяев Анатолий Владимирович
• Название сайта
• Сотрудники кафедры магнетизма: Рыжанова Наталья Григорьевна

This file is an archive of all of the changes which have been made to the Bright Supernovae pages in 1998 (which is when I started logging them). ... Added images from this page to the 1997cw and 1997cx entries. ... Added several images to the 1996 SN , 1997 SN , 1998 SN , 1998S , and 1998eg pages from "The Astronomer" mag Variables, Novae and Supernovae Images page. ... Added images to the 1998aq , 1998S , 1998bu , and 1998es web pages from a list of images on Laszlo Kiss's Latest images web page. ...

Еще в разделе: (Показать все результаты (>109) - www.rochesterastronomy.org/ )