Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...
... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...
... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...
. Fig. 2. A - Thermodependent changes of PSI delayed fluorescence intensity (1) and chlorophyll bleaching rate (2-5) in the S. elongatus membranes at I=8 W m -2 . 2-5 - rates of chlorophyll bleaching in control (2), in presence of 1 mM MgBr 2 (3), 2 mM sodium ascorbate (4) and anaerobic conditions (5). B - Correlation between DF intensity and rate of chlorophyll bleaching in control obtained at temperatures: 60 (1); 65 (2); 70 (3); 75 (4); 78 (5) and 80 (6) o C.
О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...
[
Текст
]
Ссылки http://hit-conf.imec.msu.ru/2012/abstracts/AbstractKonyukhovLikhachev.doc -- 263.5 Кб -- 14.06.2015 Похожие документы
... 2 · , , · · , 03.12.2015 . ... 14 03.12.2015 · · · 03.12.2015 . ... Verifier Uni ve rsi ty of Te x as 2013 Anteater Uni ve rsi ty of Il l i noi s 2011 FlowChecker Uni ve rsi ty of North Carol i na 2010 VERMONT Network disjoint Port #02 Port #03 h2 h3 s1 Port #01 h1 Port #04 h4 main: disjoint() := Forall[x, out_x, y, out_y: !R(x, out_x) or !R(y, out_y) or x[p] == out_y[p] and out_x[p] == y[p] or x VERMONT proxy CLI Packets are delivered through the control plane We can block them! ...
... Paradigm shifts by Kuhn: successive change of one model by another, rather than integration of different paradigms Progress of science: from single- to multi-model approach Some examples from natural science... · theory of light: from vibration of ether to wave-particle duality · laws of motion: from Newton's dynamics to SchrЖdinger 's and Heisenberg's formalism In social and environmental sciences appreciation of the multi-model ...
[
Текст
]
Ссылки http://oc.cs.msu.ru/eroven/NEW%20Rovenskaya%20IIASA%20conference%20presentation.pdf -- 734.1 Кб -- 06.11.2012 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Automorphisms and isomorphisms of Chevalley groups of typ e G2 over lo cal rings with 1/2 and 1/3 E. I. Bunina M.V. Lomonosov Moscow State University Russia, 119992, Moscow, Leninskie Gory, Main Building of MSU, Faculty of Mechanics and Mathematics, Department of Higher Algebra email address: helenbunina@yandex.ru Abstract. ... We describe automorphisms of Chevalley groups of type G2 over local rings with 1/2 and 1/3. ... References [1] Abe E. Automorphisms of Chevalley groups over commutative rings. ...
[
Текст
]
Ссылки http://halgebra.math.msu.su/wiki/lib/exe/fetch.php/staff:bunina:autg2_eng.pdf -- 224.0 Кб -- 13.02.2013 Похожие документы
Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...