... Полезные материалы . Ответственные за содействие трудоустройству на факультетах МГУ . Статистика по трудоустройству выпускников . Службы по трудоустройству на факультетах МГУ . Полезные ссылки по поиску работы для студентов и выпускников . Ассоциации и клубы выпускников МГУ . ... Вы находитесь на сайте Центра трудоустройства и работы с выпускниками МГУ имени М.В.Ломоносова. ... Центр трудоустройства и работы с выпускниками МГУ имени М.В.Ломоносова. ...
... Центральный узел Системы ДО МГУ. ... Применение SCORM 2004 Content Aggregation Model при создании базы данных системы дистанционного обучения ФДО МГУ. Информационная среда дистанционного обучения (ИСДО) ФДО МГУ предназначена для обеспечения коммуникационной и информационной поддержки процесса дистанционного обучения . ... В настоящее время предложено несколько стандартов электронного дистанционного образования. В настоящее время база данных ИСДО ФДО МГУ содержит более 100 таблиц . ...
Network Working Group T. Berners-Lee Request for Comments: 1945 MIT/LCS Category: Informational R. Fielding UC Irvine H. Frystyk MIT/LCS May 1996 Hypertext Transfer Protocol -- HTTP/1.0 Status of This Memo This memo provides information for the Internet community. This memo does not specify an Internet standard of any kind. Distribution of this memo is unlimited. IESG Note: The IESG has concerns about this protocol, and expects this document to be replaced relatively soon by a standards track document.
IEEE Transactions on Computational Intelligence and AI in Games (Special Issue on Brain/Neuronal-Computer Games Interfaces and Interaction), 2013, in press. ... Adapting the P300-based brain-computer interface for gaming: a review Alexander Y. Kaplan, Sergei L. Shishkin, Ilya P. Ganin, Ivan A. Basyul, and Alexander Y. Zhigalov Abstract--The P300-based brain-computer interface (P300 BCI) is currently a very popular topic in assistive technology development. ... Neurophysiol ., vol. 113, pp. ...
[
Текст
]
Ссылки http://brain.bio.msu.ru/papers/Kaplan_Shishkin_Ganin_Basyul_Zhigalov_2013_IEEE_TCIAIG__P300_BCI_games.pdf -- 638.2 Кб -- 08.01.2013 Похожие документы
Страница поддержки курса "Алгоритмы и алгоритмические языки" для 1 потока . ... Older posts . Posted on 15.01.2016 by abel . ... Второй коллоквиум по курсу состоится в субботу 05 декабря на первой паре. ... В секции рекомендуемой литературы обновлены ссылки на электронные версии методических пособий:љ 1) по языку Си и алгоритмам, 2) по экзаменационным задачам прошедших лет. ... Лекции по АиАЯ для первого потока будут проходить по средам и субботам в аудитории П6 на первой паре. ... Курс АиАЯ . ...
... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....
. CONTENTS . 0. Notation . 1. Valence electrons in a ground state of atoms and ions (108 Tables) . 2. He-like ions . 2.1 (1sns) 1; S and (2s2s) 1; S (138 Tables) . 2.2 (1snp) 1; P and (2s2p) 1; P (60 Tables) . 2.3 (1snd) 1; D and (2p2p) 1; D (46 Tables) . 2.4 (1sns) 3; S (no data) . 2.5 (1snp) 3; P (2 Tables) . 2.6 (1snd) 3; D (no data) . 3. Li-like ions (1s1snL) 2; L (10 Tables)
The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...
... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...
News of PARALLEL.RU par-news на mail.parallel.ru . ... Следующее сообщение: PARALLEL.RU - Новости, специальный выпуск [17/11/2009] . ... Выпуск 275 . 10 ноября 2009 г. ------------- Российская академия наук и Суперкомпьютерный консорциум университетов России проводят 29 марта - 2 апреля 2010 года в Уфе IV Международную конференцию Параллельные вычислительные технологии (ПаВТ'2010). http ://agora.guru.ru/pavt ------------- НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / ...
Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...
... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
Home Search Collections Journals About Contact us My IOPscience On the Routh sphere problem This content has been downloaded from IOPscience. ... 2013 J. Phys. A: Math. ... It allows us to relate the nonholonomic Routh system with the Hamiltonian system on a cotangent bundle to the sphere with a canonical Poisson structure. ... If the Hamiltonian vector field X has the form (1.4) with respect to the second Poisson bivector, we have the so-called quasi-bi-Hamiltonian system. ... 4 J. Phys. A: Math. ...
... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...
Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... Mathematical Reviews MR2056325 . What makes this new book an outstanding contribution to stability theory? First of all, the book succeeds in bringing qualitative results of the famous Russian school of applied mathematics to stability theory, making these results quantitative and applicable. ... Reviewed by Professor Wolfhard Kliem . ...