... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>99) - www.msm.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes
• ConClus

... Nonlinear spectroscopy . Nonlinear fiber optics . Attosecond optics . ... qqqqqqqqqqqq Rapidly progressing fiber-optic technologies open new avenues in biophotonics, providing an advanced platform for the creation of novel fiber-based imaging systems optical endoscopes, biophotonics-oriented fiber laser sources and optical neural interfaces. ... Как правило более точные методы регистрации ионных токов (с помощью электродов) сильнее ограничены по числу одновременно регистрируемых нейронов. ...

Еще в разделе: (Показать все результаты (>7) - photonicslab.phys.msu.ru/ )

• Nonlinear optics of ionized mediums

... about ERC . education . research . events . ... Being an effective way of acquiring knowledge, they also make a good addition to core lecture courses and involve students, postgraduates and scientists of other Russian higher education institutions and research centers in ERC activity in the initial stage. ... More information can be found at http://polly.phys.msu.ru/ru/unc/sconf.html . ... Conference on Development Prospects of Education and Research Centers in the Russian Federation . ...

Еще в разделе: (Показать все результаты (>41) - nano.msu.ru/ )

• Fundamentals of Nanotechnology, 2009 | MSU Nanotechnology Education and
• Fundamentals of Nanotechnology, 2009 | Научно-образовательный центр по

... It has been shown [1], that in some cases, in chaos set A the sub-set B can exist, in which the chaos behavior can be stabilized by external parametrical perturbations. ... As the first step I've found the A set (the set of chaotic behavior) and as a second step, by using different parameters combination (that can be consider as parameter perturbations of the system) I've found the B set (the set, where some stable cycles exists). ... For the f(x)=ax(1-x) map this is [3,8 4,0] interval. ...

Еще в разделе: (Показать все результаты (>73) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/Galss_ceramics.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/CHAOS_DNA.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/Losk_Fomina.pdf

... 10 PRINT HELLO WORLD 20 END program Hello (input, output) begin writeln(' Hello World ') end. # include stdio.h void main(void) { char *message[] = { Hello , World }; int i; for(i = 0; i 2; ++i) printf( %s , message[i]); printf( n ); } # include iostream.h # include string .h class string { private: int size; char *ptr; public: ... D % zmail all I need a "Hello, world." program by this afternoon. quit % % logout Bipppp ! ...

Еще в разделе: (Показать все результаты (>192) - www.mmonline.ru/ )

• MMOnline | Форумы | Обсуждение сайта | TEX не скачивается
• MMOnline | Форумы | Обсуждение сайта | почта не работает!
• MMOnline | Форумы | Разное | Работа в Microsoft

... x25BA; Login to the site . Skip to create new account . Login here using your username and password . ... Username . Password . ... Some courses may allow guest access . ... For full access to courses you'll need to take a minute to create a new account for yourself on this web site. ... You can now access the full course. From now on you will only need to enter your personal username and password (in the form on this page) to log in and access any course you have enrolled in. ...

139. User account | Department of Quantum Electronics

140. About - Space monitoring data center