... Полезные материалы . Ответственные за содействие трудоустройству на факультетах МГУ . Статистика по трудоустройству выпускников . Службы по трудоустройству на факультетах МГУ . Полезные ссылки по поиску работы для студентов и выпускников . Ассоциации и клубы выпускников МГУ . ... Вы находитесь на сайте Центра трудоустройства и работы с выпускниками МГУ имени М.В.Ломоносова. ... Центр трудоустройства и работы с выпускниками МГУ имени М.В.Ломоносова. ...
... Центральный узел Системы ДО МГУ. ... Применение SCORM 2004 Content Aggregation Model при создании базы данных системы дистанционного обучения ФДО МГУ. Информационная среда дистанционного обучения (ИСДО) ФДО МГУ предназначена для обеспечения коммуникационной и информационной поддержки процесса дистанционного обучения . ... В настоящее время предложено несколько стандартов электронного дистанционного образования. В настоящее время база данных ИСДО ФДО МГУ содержит более 100 таблиц . ...
ISSUE 1 RUSSIA U.S. BILATERAL ON CYBERSECURITY CRITICAL TERMINOLOGY FOUNDATIONS APRIL 2011 The Russia U.S. Bilateral on Cybersecurity Critical Terminology Foundations Issue 1 The principle editors of this document are: Karl Frederick Rauscher, EastWest Institute and Valery Yaschenko, Information Security Institute of Moscow State University. ... INFORMATION AND CYBER .. ... Scientific Adviser to the Director of the Lomonosov Moscow State University Institute of Information Security Issues. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf -- 2087.2 Кб -- 27.09.2013 Похожие документы
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
Network Working Group T. Berners-Lee Request for Comments: 1945 MIT/LCS Category: Informational R. Fielding UC Irvine H. Frystyk MIT/LCS May 1996 Hypertext Transfer Protocol -- HTTP/1.0 Status of This Memo This memo provides information for the Internet community. This memo does not specify an Internet standard of any kind. Distribution of this memo is unlimited. IESG Note: The IESG has concerns about this protocol, and expects this document to be replaced relatively soon by a standards track document.
Страница поддержки курса "Алгоритмы и алгоритмические языки" для 1 потока . ... Older posts . Posted on 15.01.2016 by abel . ... Второй коллоквиум по курсу состоится в субботу 05 декабря на первой паре. ... В секции рекомендуемой литературы обновлены ссылки на электронные версии методических пособий:љ 1) по языку Си и алгоритмам, 2) по экзаменационным задачам прошедших лет. ... Лекции по АиАЯ для первого потока будут проходить по средам и субботам в аудитории П6 на первой паре. ... Курс АиАЯ . ...
... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....
. CONTENTS . 0. Notation . 1. Valence electrons in a ground state of atoms and ions (108 Tables) . 2. He-like ions . 2.1 (1sns) 1; S and (2s2s) 1; S (138 Tables) . 2.2 (1snp) 1; P and (2s2p) 1; P (60 Tables) . 2.3 (1snd) 1; D and (2p2p) 1; D (46 Tables) . 2.4 (1sns) 3; S (no data) . 2.5 (1snp) 3; P (2 Tables) . 2.6 (1snd) 3; D (no data) . 3. Li-like ions (1s1snL) 2; L (10 Tables)
... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...
News of PARALLEL.RU par-news на mail.parallel.ru . ... Следующее сообщение: PARALLEL.RU - Новости, специальный выпуск [17/11/2009] . ... Выпуск 275 . 10 ноября 2009 г. ------------- Российская академия наук и Суперкомпьютерный консорциум университетов России проводят 29 марта - 2 апреля 2010 года в Уфе IV Международную конференцию Параллельные вычислительные технологии (ПаВТ'2010). http ://agora.guru.ru/pavt ------------- НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / ...
MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...
Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...
Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...
... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... Mathematical Reviews MR2056325 . What makes this new book an outstanding contribution to stability theory? First of all, the book succeeds in bringing qualitative results of the famous Russian school of applied mathematics to stability theory, making these results quantitative and applicable. ... Reviewed by Professor Wolfhard Kliem . ...
Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...