Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>3) - mph.cmc.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>93) - npidb.belozersky.msu.ru/ )

• Index of /data
• Index of /data/html_scop
• Index of /data/pdb_new

. Name . Last modified . Size . Description . Parent Directory . - . 1/ . 31-Oct-2007 14:50 . - . 3/ . 21-Nov-2007 11:33 . - . Apache/2.2.16 (Debian) Server at educenter.sinp.msu.ru Port 80

Еще в разделе: (Показать все результаты (>9) - educenter.sinp.msu.ru/ )

• Index of /about_center
• Index of /sections
• Index of /sections/education

... Parent Directory - 1-1-GeneralTopology-Conspectus-2009.pdf 26-Aug-2009 19:49 189K 1-1-GeneralTopology-Conspectus-Addendum-5-5-2009.pdf 09-Sep-2009 12:56 131K 1-4-Examples-Addendum.pdf 22-Sep-2009 11:50 89K Alexandrov-168-169.pdf 08-Sep-2009 12:36 225K ControlWorks/ 05-Sep-2009 15:50 - FAQ/ 08-Sep-2009 13:53 - Poincare.pdf 08-Nov-2007 15:29 296K Program-2009.pdf 16-Aug-2009 12:31 89K Test1-2009.pdf 28-Aug-2009 15:42 83K UchPr-2009.htm ...

Еще в разделе: (Показать все результаты (>278) - higeom.math.msu.su/ )

• Index of /people/ssmirnov/pics/jdm/France
• Index of /people/ssmirnov/pics/jdm/Spain
• Index of /people/ssmirnov/pics/jdm/China

... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...

Еще в разделе: (Показать все результаты (>14) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>222) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Description
• SAI Open Star Clusters (SAI OCL) Catalog

. Fig. 2. A - Thermodependent changes of PSI delayed fluorescence intensity (1) and chlorophyll bleaching rate (2-5) in the S. elongatus membranes at I=8 W m -2 . 2-5 - rates of chlorophyll bleaching in control (2), in presence of 1 mM MgBr 2 (3), 2 mM sodium ascorbate (4) and anaerobic conditions (5). B - Correlation between DF intensity and rate of chlorophyll bleaching in control obtained at temperatures: 60 (1); 65 (2); 70 (3); 75 (4); 78 (5) and 80 (6) o C.

Еще в разделе: (Показать все результаты (>10) - biophys.msu.ru/ )

• Stress of plant cells

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>21) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2012/abstracts/Kurbatsky.doc
• http://hit-conf.imec.msu.ru/books/NeZaTeGiUs_2010.pdf
• Index of /2006/CD

... 2 Ї ґ , , Ї ґ Ї ґ , 03.12.2015 . ... 14 03.12.2015 Ї Ї Ї 03.12.2015 . ... Verifier Uni ve rsi ty of Te x as 2013 Anteater Uni ve rsi ty of Il l i noi s 2011 FlowChecker Uni ve rsi ty of North Carol i na 2010 VERMONT Network disjoint Port #02 Port #03 h2 h3 s1 Port #01 h1 Port #04 h4 main: disjoint() := Forall[x, out_x, y, out_y: !R(x, out_x) or !R(y, out_y) or x[p] == out_y[p] and out_x[p] == y[p] or x VERMONT proxy CLI Packets are delivered through the control plane We can block them! ...

Еще в разделе: (Показать все результаты (>8) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf

... Paradigm shifts by Kuhn: successive change of one model by another, rather than integration of different paradigms Progress of science: from single- to multi-model approach Some examples from natural science... Ї theory of light: from vibration of ether to wave-particle duality Ї laws of motion: from Newton's dynamics to SchrЖdinger 's and Heisenberg's formalism In social and environmental sciences appreciation of the multi-model ...

Еще в разделе: (Показать все результаты (>6) - oc.cs.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

Automorphisms and isomorphisms of Chevalley groups of typ e G2 over lo cal rings with 1/2 and 1/3 E. I. Bunina M.V. Lomonosov Moscow State University Russia, 119992, Moscow, Leninskie Gory, Main Building of MSU, Faculty of Mechanics and Mathematics, Department of Higher Algebra email address: helenbunina@yandex.ru Abstract. ... We describe automorphisms of Chevalley groups of type G2 over local rings with 1/2 and 1/3. ... References [1] Abe E. Automorphisms of Chevalley groups over commutative rings. ...

Еще в разделе: (Показать все результаты (>11) - halgebra.math.msu.su/ )

• http://halgebra.math.msu.su/wiki/lib/exe/fetch.php/staff:yjabr12829.pdf

... Changed pages: posts/seminar-24.03.2016 . Changed by: alexeybrazhe . Commit type: git . ... Changed pages: posts/seminar-03.12.2015 . ... Changed pages: posts/seminar-25.12.2014 . ... Changed pages: posts/seminar-03.03.2015 posts/seminar-10.03.2015 . ... Changed pages: local.css posts/seminar-03.03.2015 . ... Changed pages: local.css posts/seminar-24.09.2013 . ... Changed pages: local.css media/files/seminar-24.09.2013.2.png media/files/Киселева автореферат.doc posts/seminar-24.09.2013 . ...

Еще в разделе: (Показать все результаты (>4) - cell.biophys.msu.ru/ )

. Name . Last modified . Size . Description . Parent Directory . - . operating_systems.ppt . 2011-03-21 02:27 . 218K . presentation-3.ppt . 2011-03-14 02:45 . 53M . questions_2011.doc . 2011-03-23 15:27 . 26K . translators.ppt . 2011-03-14 02:43 . 296K . Apache/2.4.10 (Debian) Server at asvk.cmc.msu.ru Port 80

135. Index of /tomilin

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда