... Results of experimental and numerical investigations of a permeable round parachute with the stripe-stabilizer, the so called "SAL" parachute - Stabilization of Aerodynamic Loads, are given [1]. ... The parachute canopy attained different shapes from each other depending on the value of reefing ( Fig.1 ). ... As given below some numerical investigations of the stripe-stabilizer reefing influence on the canopy shape, its aerodynamic drag and the tension of radial ribbons are considered. ...
... Дипломная работа на тему: Алгоритм построения распределения градиентов и полные наборы на алгебрах Ли малой размерности. ... Априори неизвестно, на каждой ли конечномерной алгебре Ли существует хотя бы один полный коммутативный набор полиномов. ... Чтобы получить полный коммутативный набор на первоначальной алгебре A4,8 необходимо к полиномам, соответствующим полному набору на алгебре a добавить базис в идеале (линейные полиномы). ... К полученным полиномам добавить полный набор на h1 . ...
[
Текст
]
Ссылки http://dfgm.math.msu.su/files/0students/2007-dip-korotkevich.pdf -- 339.1 Кб -- 03.05.2007 Похожие документы
Variability of the specific fluorescence of chlorophyll in the o cean. Part 2. ... Abstract Two methods of determining the chlorophyll a concentration in the sea have been formulated on the basis of artificially induced fluorescence measured with the aid of submersible fluorometers. The method of statistical correlation is founded on the empirical relationship between fluorescence and chlorophyll concentration. ... Variability of the specific fluorescence of chlorophyll in the ocean. ...
... 2007 PDF created with pdfFactory Pro trial version www.pdffactory.com . ... x, t ) : =0. (1.2) t 2 x 2 , , OX : (1.3) ( x, t ) = a 0 cos( t - kx + 0 ) 2 ( x, t ) -c 2 2 ( x, t ) PDF created with pdfFactory Pro trial version www.pdffactory.com ?1. 7 (1.4) ( x, t ) = Re{a0 e i ( t - kx + 0 ) } . ... dV m = -eE 0 cos( t ) , dt PDF created with pdfFactory Pro trial version www.pdffactory.com ?1. m = 9,1 10 -31 e = 1,6 10-19 - , - , V - , eE sin(t ) V= 0 m (W ) = 15 , . ... x2 + y 2 2 exp - t . ...
[
Текст
]
Ссылки http://ofvp.phys.msu.ru/upload/iblock/c19/ekbtshjo_.pdf -- 938.4 Кб -- 03.09.2009
[
Текст
]
Ссылки http://www.ilc.msu.ru/upload/iblock/c19/ekbtshjo_.pdf -- 938.4 Кб -- 03.09.2009
[
Текст
]
Ссылки http://ilc.phys.msu.ru/upload/iblock/c19/ekbtshjo_.pdf -- 938.4 Кб -- 03.09.2009 Похожие документы
________________________________________________ Space Environment (Natural and Artifical) Probabilistic model for fluences and peak fluxes of solar energetic particles Part I Protons Technical Specification ___________________________________________________________ ... Proton energy [MeV]. ... Differential proton fluence energy (E) distribution in a single SEP event (or in a set of SEP events) [proton/(cm2·MeV)]. ... Probability for a given peak flux SEP with energy E to be exceeded. ...
... Система анализирует исходные файлы проекта и собирает списки Пространств имен Классов Функций Переменных Взаимосвязи между ними (может строить и графические диаграммы наследования, включений и т.п. (для построения диаграмм используется программа GraphViz) Можно писать свои расширенные комментарии с формулами (для этого придется поставить TeX) Все перечисленные программы официально являются бесплатными и существуют как для Windows так и UNIX, причем полностью совместимы. ...
... конференций . ... сайтов . ... На страницах сайта разместите ссылки вида http://agora.guru.ru/YourConf/rus и http://agora.guru.ru/YourConf/eng , где YourConf - имя (логин) вашей конференции. ... Как разместить произвольный файл (JPG, PDF, DOC, ...) на сайте конференции? ... Вход для экспертов - на странице http://agora.guru.ru/YourConf/exp , где YourConf - имя (логин) вашей конференции. ... Для администраторов - давайте только короткие ссылки на сайты: http://agora.guru.ru/conference_name. ...
... Phyllosilicates may form in EKB bodies during aqueous alteration [7]. ... The time m required to heat a large EKB body to the water - ice melting point and to melt the ice in its interiors can be estimated from the equation 0 Q exp(-t )dt = Tm T0 c p dT + L f m w , (1) where T0 = 30 K is the adopted value for the initial temperature of the body , Tm = 273 K is the melting temperature of water ice (a good approximation to at P 25 MPa, characteristic for interiors of a EKB ...
... Run program . User's guide . Launching program . Input data format . ... Selecting the number of correlated pairs . ... In order to run thr program one needs Java 5.0 environment. ... At the end of computations one will be asked to review the selected number of correlated pairs. ... Note: One may redefine the number of correlated pairs by selecting the 'Edit' -> 'redefine correlated pairs number' menu item. Correlated pairs of positions are presented as a colored matrix, the heatmap. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... V.S. Dneprovskii, V.I. Klimov, D.K. Okorokov and Yu.V. Vandyshev. ... Quantum size effect and pronounced optical nonlinearities in porous silicon. ... Phys. 79 , 994 (1994). ... Saturation of optical transitions in quantum dots and wires of porous silicon. ... V. Dneprovskii, N. Gushina, O. Pavlov, V. Poborchii, I. Salamatina and E. Zhukov. ... Strong Optical Nonlinearities in Quantum Wires and Dots of Porous Silicon. ... Nonlinear-optical properties of semiconducting quantum wires and dots. ...
... In brief, optimization requires that the outer layer be as heavy as allowed, while the inner layer should be a material with a low modulus and should be as thick as can be tolerated. xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ... xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxx xxxxxxxxxxxx xxxxxxxxxxxx xxxxxxxxxxxx xxxxxxxxxxxx ... we will use the frequency f = ! ...
[
Текст
]
Ссылки http://num-meth.srcc.msu.ru/english/zhurnal/tom_2006/ps/v7r103.ps -- 2317.0 Кб -- 13.01.2006 Похожие документы
... In the literature it is often referred to as electron momentum spectroscopy (EMS) (see Refs. [2, 3] and references therein). ... 2.0 LP, N = 0, Ion : ground RHF , field-free SPM , field-free BK, field-free RHF SPM BK 2.0 LP, N = 0, Ion : ground RHF , field-free SPM , field-free BK, field-free RHF SPM BK ] a.u . [ 3 TDCS x 10 1.0 TDCS x 10 3 0.5 0.0 0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 [ 1.0 0.5 0.0 0.0 p F(t) 0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 F(t) 8.0 q [ ...
... Выпускник должен обладать следующими профессиональными компетенциями (ПК): общепрофессиональными: способностью свободно владеть фундаментальными разделами физики , необходимыми для решения научно-исследовательских задач (в соответствии со своей магистерской программой) (ПК-1); способностью использовать знания современных проблем физики , новейших достижений физики в своей научно-исследовательской ... Павлов П.В., Хохлов А.Ф. Физика твердого тела. ... Задачи по физике твердого тела. ...
... Application of Artificial Neural Networks to Solve Problems of Identification and Determination of Concentration of Salts in Multi Component Water Solutions by Raman Spectra1 S. A. Burikova, S. A. Dolenkob, T. A. Dolenkoa, and I. G. Persiantsevb a Department of Physics, M.V. Lomonosov Moscow State ... Some statistics for NN determination of concentrations of salts in multi component solutions by Raman spectra within the "experiment based" and "quasi model" approaches. ...
... 4 1.1 Основные одночастичной механики положения квантовой Главный постулат квантовой механики состоит в том, что вся динамика любой системы определяется ее волновой функцией, которая является комплексной функцией от координат все частиц, составляющих эту систему: (t, r1 , r2 , . ... Эта волновая функция должна рассматриваться как вектор в гильбертовом пространстве состояний функции n частичной системы. ... j =1 32 Запутанные состояния играют центральную роль в квантовой теории многих частиц. ...
[
Текст
]
Ссылки http://sqi.cs.msu.su/store/storage/th25kzj_quantum_computer.pdf -- 426.1 Кб -- 25.11.2014 Похожие документы