Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... ELFIN-L . ... It consist of a Flux Gate Magnetometer (FGM), an Energetic Particle Detector for Electrons (EPDE), and an Energetic Proton Detector for Ions (EPDI). ... Energetic particles create a hazardous environment for satellites and humans in space and cause a number of satellite failures. ... Magnetospheric particles and radiation environment . ...

Еще в разделе: (Показать все результаты (>38) - lomonosov.sinp.msu.ru/ )

• DEPRON | Университетский спутник "Ломоносов"

... О UNИX . ... PSPO/Policy/Materials . Неизменяемая страница . ... Макрос и действие CreateMaterialPassport, которые позволяют создавать страницы паспорта, используя формочку (по аналогии с макросом/действием NewPage) . ... Внизу сгенерированной страницы имеется макрос <<MaterialFiles()>> . ... eSyr/WikiHack/Macros/CreateMaterialPassport . eSyr/WikiHack/Actions/CreateMaterialPassport . ... PSPO/Policy/Materials (последним исправлял пользователь eSyr 2009-10-26 11:36:13) . ...

Еще в разделе: (Показать все результаты (>226) - uneex.lorien.cs.msu.su/ )

• HelpOnMoinCommand/ExportDump - UNИX
• Chapter€а8.€а Combining images with GIMP
• HelpOnInstalling/StandaloneServer - UNИX

... О UNИX . ... PSPO/Policy/Materials . Неизменяемая страница . ... Макрос и действие CreateMaterialPassport, которые позволяют создавать страницы паспорта, используя формочку (по аналогии с макросом/действием NewPage) . ... Внизу сгенерированной страницы имеется макрос <<MaterialFiles()>> . ... eSyr/WikiHack/Macros/CreateMaterialPassport . eSyr/WikiHack/Actions/CreateMaterialPassport . ... PSPO/Policy/Materials (последним исправлял пользователь eSyr 2009-10-26 11:36:13) . ...

Еще в разделе: (Показать все результаты (>93) - uneex.mithril.cs.msu.su/ )

• HelpOnMoinCommand/ExportDump - UNИX
• PspoMaterials/GnumericDoc_ru - UNИX
• HelpOnInstalling/StandaloneServer - UNИX

Anchors, embedded images, and all other elements which contain URIs as parameters may cause the URI to be dereferenced. In this case, the security considerations of the URI specification apply. ... The MD attribute is useful when authors are concerned that a linked object may be subsequently changed to something other than intended. This attribute is used to specify a cryptographic checksum for the linked object to provide a check on its integrity. ...

Еще в разделе: (Показать все результаты (>111) - comet.sai.msu.ru/ )

• Multiwavelength Study of Mira Ceti-Type Variable Stars
• Passing arguments to the shell
• Rudnitskij Georgij M. Home Page

. Название публикации . Mechanical properties of human soleus fibers after 7-day dry immersion. Effects of plantar support stimulation and high frequency electrical stimulation . Авторы . I.V. Ogneva, E.V. Ponomareva, E.G. Altaeva, N.M. Fokina, V.A. Kurushin, I.B. Kozlovskaya, B.S. Shenkman . Дата . 31.12.2009 23:00:00 . Название журнала . Acta Astronautica. Купить нет на складе . 2009 ФФМ МГУ, 2009

Еще в разделе: (Показать все результаты (>20) - fbm.msu.ru/ )

... Новости лаборатории . ... Romanova N.A., Fritz M.A., Tamm N.B., Troyanov S.I. Synthesis and X-ray structure of C 2 -C 84 (22)(CF 3 ) 6 , Mend. ... 2014) 24 , 78-79 DOI . ... Konarev D.V., Romanova N.A., Panin R.A., Goryunkov A.A., Troyanov S.I., Lyubovskaya R.N. Magnetic coupling and optical properties of the S 6 -dodecakis(trifluoromethyl)fullerene radical anions in the layered salt (PPN + )[C 60 (CF 3 ) 12 .- ... Copyright 2006-2012, Лаборатория термохимии, Московский государственный университет ....

Еще в разделе: (Показать все результаты (>24) - thermolab.chem.msu.ru/ )

... Main practical applications of X-rays lie in the important for the society fields of medical imaging, custom, transport inspection and security. Scientific applications besides of fundamental research include material sciences, biomicroscopy, and protein crystallography. ... The first are relatively cheap, robust, and compact but have low brightness and poorly controlled photon spectrum. ... So accelerator based X- ray sources are mainly still used for scientific applications and X-ray tubes ? ...

Еще в разделе: (Показать все результаты (>8) - miles.sinp.msu.ru/ )

... Prof, head of the laboratory of x-ray diffraction and crystal chemistry Home address: Russia, 115470, Prosp. ... 1964-1969 a student of Geological faculty MSU, department of crystallography 1969-1973 a post graduate student (scientific advisor academician N.V.Belov) 1974 Ph.D., speciality 'Crystallography and Crystalphysica', title of Ph.D. Thesis 'Crystal structures of (Na,Cd)-germanates' 1994 D.Sc., speciality 'Physical chemistry', title of D.Sc. ... E.L.Belokoneva, L.I.Leonjuk, V.S.Urusov. ...

Еще в разделе: (Показать все результаты (>59) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/courses/crchem/urusov2.pdf
• http://cryst.geol.msu.ru/staff/yakubovich.php
• http://cryst.geol.msu.ru/literature/2008.php

... Sergey V. Borisov . ... Kaplan A.Ya ., Borisov S.V. , Zheligovsky V.A. Classification of EEG's of adolescents based on spectral and segment parameters for the purposes of schizophrenia diagnostics // Biological Psychiatry, 2005 (ISSN 0006-3223), submitted . Borisov S.V. , Kaplan A.Ya ., Gorbachevskaya N.L., Kozlova I.A. Structural organization of the EEG alpha activity in adolescents with schizophrenic spectrum disorders // Zh . ... Borisov S.V. , Gorbachevskaya N.L., Kaplan A.Ya . ...

Еще в разделе: (Показать все результаты (>76) - brain.bio.msu.ru/ )

... Research laboratories . ... The renewable energy resources geography in Russia and the world. ... Laboratory relationship with research organizations, including international: Moscow Power Energy Institute , Oceanology Institute RAS, Russia s Institute for Rural Electrification RAS, United Institute for High Temperatures RAS, Governmental Energy Strategy Institute , Geography Institute RAS, Experimental Meteorology Institute , Governmental Research ... Renewable energy sources...

Еще в разделе: (Показать все результаты (>69) - eng.geogr.msu.ru/ )

• Department of Oceanology
• Department of Environmental Management

... 60° , /2 , / , / , / , / 2 2 2 482 152 0,03 16 1,4 634 0,07 , / 0,05 157 174 0,64 37 3,4 331 0,52 0,10 97 182 0,75 44 4,1 279 0,59 0,15 70 186 0,79 47 4,4 256 0,63 3 0,20 54 188 0,82 49 4,5 242 0,65 0,25 44 190 0,83 50 4,6 234 0,66 5 0,1 /3. ... 1961. ... Rockel B., Raschke E., Weyres B. A parameterization of broad band radiative transfer properties of water, ice and mixed clouds // Beitr. ... Slingo A. A GCM parameterization for the shortwave radiative properties of water clouds // J. Atmos. Sci. ...

Еще в разделе: (Показать все результаты (>7) - atm563.phys.msu.ru/ )

... Querying File Parameters . Up: File Manipulation Next: File Info Previous: Querying the Size of a File . MPI_FILE_GET_GROUP(fh, group) . ... OUT group] group which opened the file (handle) . int MPI_File_get_group(MPI_File fh, MPI_Group *group) . MPI_FILE_GET_GROUP(FH, GROUP, IERROR) . ... MPI::Group MPI::File::Get_group() const . MPI_FILE_GET_GROUP returns a duplicate of the group of the communicator used to open the file associated with fh. ... MPI_FILE_GET_AMODE(fh, amode) . ...

Еще в разделе: (Показать все результаты (>489) - www.parallel.ru/ )

• MPE_Open_graphics | PARALLEL.RU - Информационно-аналитический центр по
• MPI_Alltoallv | PARALLEL.RU - Информационно-аналитический центр по параллельным
• MPI_Alltoall | PARALLEL.RU - Информационно-аналитический центр по параллельным

... Новости . ... Музей . антропологии . ... Вестник МГУ Антропология . ... 26 ноября Музее антропологии открылась этнографическая выставка . ... Антропология" . ... Посмотреть фотографии . ... 2008-2010 Научно-исследовательский институт и Музей антропологии им.Д.Н.Анучина . Копирование материалов web-сайта только с разрешения администрации НИИ и Музея антропологии МГУ! ... При использовании материалов, размещенных на сайте НИИ и Музея антропологии МГУ, ссылка на источник обязательна! ...

Еще в разделе: (Показать все результаты (>31) - www.anthropos.msu.ru/ )

. Московский государственный университет имени М.В. Ломоносова . Физический факультет . Кафедра небесной механики, астрометрии и гравиметрии . УЧЕБНЫЕ МАТЕРИАЛЫ ДЛЯ СТУДЕНТОВ КАФЕДРЫ . Емельянов Н.В. Основы теории возмущений в небесной механике. Емельянов Н.В. Конспекты лекций по практической небесной механике. Практикум по небесной механике.

Еще в разделе: (Показать все результаты (>25) - www.sai.msu.ru/ )

• IMCCE-SAI: Natural Satellites Service. Parameters and constants

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Comparison of protein phylogeny reconstruction methods

Преподаватели ВШБ МГУ Сергей Заверский и Наталья Чуркина выступили на международной конференции 'The Social Economy. Corporate Responsibility, Private Property Partnerships, Workers' Rights and Cooperatives' в Испании. ... Преподаватели ВШБ выступили с презентацией доклада Business Response to Environmental Challenges: Three Cases of Russian Companies на секции Corporate Social Responsibility and the Environment . ...

Еще в разделе: (Показать все результаты (>199) - www.mgubs.ru/ )

Russian Entomol. J. 17(1): 1718 ї RUSSIAN ENTOMOLOGICAL JOURNAL, 2008 New data on Leptoconops minutus Gutsevich (Diptera: Leptoconopidae) from southeastern Kazakhstan Новые данные о Leptoconops minutus Gutsevich (Diptera: Leptoconopidae) из юго-восточного Казахстана G.A. Auezova Г.А. Ауэзова Institute of Zoology, Ministry of Education and Science of Kazakhstan, pr. ... The female of Leptoconops minutus, a poorly known species, is illustrated for the first time from material from SE Kazakhstan. ...

Еще в разделе: (Показать все результаты (>1552) - zmmu.msu.ru/ )

• http://zmmu.msu.ru/files/images/spec/2010%20VZ_N5_Zelotes.pdf
• http://zmmu.msu.ru/files/images/spec/Russ%20Ent%20J/ent20_3%20255_257%20Dubovikov%20for%20Inet.pdf
• Definition of the type material of several nominal taxa of pikas (Lagomorpha:

... All the galaxies are divided into 4 groups depending on the environment type; every subsample contains more than 10 galaxies. ... An effect of environments is seen both for the nuclei and for the bulges: if we consider the clusters (Virgo and Ursa Ma jor) and group centers as dense environments and the field and group periphery as sparse environments, then in the dense environments the stellar populations of S0s are in average older by 4­5 Gyr than in the sparse ones. ...

Еще в разделе: (Показать все результаты (>49) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/iau245sil.pdf
• http://sn.sai.msu.ru/~sil/preprints/s0_3.ps.gz

О лаборатории . ... Лаборатория теоретической биофизики . ... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... We use OPLS-AA with some includings; ?includings? are overlays on the standart GROMACS forcefield files. ... All-atom automatic OPLS-AA topology generator . ... comcon1 in All-atom automatic OPLS-AA topology? . ... OPLS-AA? in All-atom automatic OPLS-AA topology? ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>58) - erg.biophys.msu.ru/ )

• Using RESP with GAMESS-US and Firefly (PC-GAMESS) ERG Research Group:
• Quantum chemistry information page ERG Research Group: Лаборатория
• Gaussian Cube files loader ERG Research Group: Лаборатория теоретической