... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>4) - composite.msu.ru/ )

• Pobedria Boris Efimovich
• INTAS 95-525 Project Main Page

... About the project . ... Biological information . As part of the project areas we will develop the scientific basis for the creation of infrastructure solutions and knowledge-based platforms for a comprehensive biodiversity study in Russia on the basis of genomic and storage technologies, analysis and exchange of data different types. ... Solution of problems set out in the project area will have the long-term effect in the various fields of science and engineering disciplines in the social sphere. ...

Еще в разделе: (Показать все результаты (>15) - depository.msu.ru/ )

• Microorganism and fungi | depozitariy
• Board of directors | depozitariy
• Human biomaterial | depozitariy

... DNA chains . RNA chains . Protein chains . ... TRANSFERASE/DNA . ... dna . ... ANTIBIOTIC/DNA . ... TRANSCRIPTION/DNA . ... 1997-12-10 . ... VIRAL PROTEIN/RNA . ... rna . ... ISOMERASE/DNA . ... VIRUS/RNA . ... TRANSCRIPTION/RNA . ... VIRAL PROTEIN/DNA . ... HYDROLASE/DNA . ... RNA BINDING PROTEIN/RNA . ... DNA BINDING PROTEIN/DNA . ... TRANSFERASE/RNA . ... GENE REGULATION/DNA . ... GENE REGULATION/RNA . ... HYDROLASE/RNA . ... PROTEIN/DNA . ...

Еще в разделе: (Показать все результаты (>39) - monkey.belozersky.msu.ru/ )

• NPIDB

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>5) - compmech.math.msu.su/ )

• Список публикаций - А. Н. Козлова - Кафедра вычислительной механики

Combination of high resolution mass -spectrometry (FT-ICR) and nuclear magnetic resonance ( NMR ) for analysis of mumijo (shilajit) Gleb Vladimirov1, Anton Grigoryev1,5, Alexey Kononikhin1,2, Norbert Hertkorn4, Andrey Konstantinov3, Irina Perminova3, Igor Popov1.2, Eugene Nikolaev1,2 Institute For Energy Problems of Chemical Physics RAS, Moscow , Russia Institute of Biochemical Physics RAS, Moscow , Russia 3 Lomonosov Moscow State University, ...

Еще в разделе: (Показать все результаты (>117) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/ihss/pdf/IHSS15-Flyer.pdf
• http://www.mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf
• http://www.mgumus.chem.msu.ru/publication/2010/2010-kazachkov-optimization.pdf

Mishchenko Alexandr S. was born 18.08.1941, Rostov-Don. He has graduated the Department of Mathematics and Mechanics of Moscow State University (1965). ... Professor of the Chair of higher geometry and topology of the Department of Mathematics and Mechanics of MSU (1979). Leading researcher of the Steklov mathematical institute of RAS. ... Leader of Moscow scientific school on non commutative geometry and topology. Area of scientific interest: geometry and topology and their applications. ...

Еще в разделе: (Показать все результаты (>138) - higeom.math.msu.su/ )

• C*-algebras and elliptic theory
• Conferences (English)
• Publications (English)

M. A. Vorotyntsev 1 1,2,3, D. V. Konev3, M. Skompska 4 ICMUB-UMR 6302 CNRS, Universite de Bourgogne, Dijon, France 2 M. V. Lomonosov Moscow State University, Russia 3 Institute for Problems of Chemical Physics, Chernogolovka, Russia 4 University of Warsaw, Poland mivo2010@yandex.com, mv@elch.chem.msu.ru, mv@u-bourgogne.fr In situ measurements of specific conductivity of films on electrode surface Specific conductivity: function of potential Impedance problems: 1. ... Which thickness? ...

Еще в разделе: (Показать все результаты (>63) - electr003.chem.msu.ru/ )

• Theory as a Lighthouse in the Electrochemical Ocean
• Laboratory of Electrical Double Layer and Electrode Kinetics
• In memory of Sasha Kuznetsov

... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...

Еще в разделе: (Показать все результаты (>15) - imk.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Anisotropy of Cosmic Rays. Origins, experiments, data analysis problems & methods. ... ANTARES problems and methods. ... 2D» experiments Name Tibet Air Shower Array Position 90.522o E, 30.102o N; 4300 m above sea level 30.11 N, 4300m a.s.l. Gran Sasso, 2000m Caucasus, 1700m (40deg N, 113 deg W), atmospheric depth of 860 gm/cm2 Energy 4,6.2,12,50, 300 TeV Gamma /CR mix Time 1997-1999 TibetII, 1999-2001 TibetIII (bigger HD array). 4 years 1 year Statistics 7x109 in ~1000 days Rate Ang. ...

Еще в разделе: (Показать все результаты (>16) - antares.sinp.msu.ru/ )

SEISMIC DATA INTERPRETATIO N Graduate program "Applied Tectonics and Dynamic&Structural Geology" is intended for advanced studies in the classical chapters of Tectonics TECTONICS AND GEOLOGICAL and used to solve applied geological problems. All major areas, such as ANALYSIS FOR EXPLORATION Tectonics, Structural Geology, Geological Interpretation of the Geophysical Data and practical approaches for applied geological analysis, are covered by this graduate program. ...

Еще в разделе: (Показать все результаты (>17) - dynamo.geol.msu.ru/ )

Lomonosov Moscow State University, Faculty of Mechanics and Mathematics, English Department On Borsuk's problem by A. Lukina, group 305, English teacher: A.A.Savchenko 1. ... It studies combinatorial properties of finite or discrete bodies or bodies with some particular characteristics, for instance, of a certain diameter. ... A number of questions arise from this problem. ... It is useful to deal with not just a body of diameter one, but with its approximation, called universal cover system. ...

Еще в разделе: (Показать все результаты (>20) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Academic_English_part3.pdf
• http://www.eng.math.msu.su/download/theses3.pdf

... The RELEC experiment was specially developed for study of relativistic electrons in near-Earth space together with TLEs in order to test possible connection between these two phenomena. ... Data from RELEC mission will be processed for testing TLE models, studying of TGF light curves and spectra, testing possible connection between electron precipitations and low-frequency electromagnetic waves. ... Energy range: 0.1 - 15 MeV (for electrons) . ...

Еще в разделе: (Показать все результаты (>8) - vernov-relec.sinp.msu.ru/ )

. Information by your request is not available. This is ejudge contest administration system, version 3.5.1+ (GIT 2eb5ef0), compiled 2016-03-20 11:30:56. This program is copyright 2000-2016 Alexander Chernov. This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation ; either version 2 of the License, or (at your option) any later version. Visual design and web-interface 2006-2016 Toto Lasvik .

Еще в разделе: (Показать все результаты (>7) - acm.msu.ru/ )

. If you see this page, the nginx web server is successfully installed and working. Further configuration is required. For online documentation and support please refer to nginx.org . Commercial support is available at nginx.com . Thank you for using nginx.

137. Научная Сеть >> Приз в 1 миллион долларов за решение каждой из семи

138. http://www.rsr-online.ru/doc/norm/94.doc

139. http://www.elch.chem.msu.ru/mole/lecture/qantipov.pdf

140. Imaging lab: people