Summary of results and experience in Data Science Alexander P. Ryjov Associated Professor, Chair of Mathematical Foundations of Intelligent Systems, Department of Mechanics and Mathematics, Lomonosov Moscow State University, Professor and Head, Chair of Business Processes Management Systems, IT Business School, Russian Presidential Academy of National Economy and Public Administration. ... Systems for evaluation and monitoring of complex processes. ... Banks: credit scoring system. ...

Еще в разделе: (Показать все результаты (>124) - www.intsys.msu.ru/ )

• Intelligent Systems :: Teaching
• Intelligent Systems :: Research :: :: Articles
• Intelligent Systems :: Staff :: Kudryavtsev Valery Borisovich

... Программа на сентябрь 2008 г. 24 сентября. H. Wakaki (Hiroshima University). An error bound for Box's chi-square type asymptotic expansion of Wilks' Lambda distribution. Abstract. An error bound for the Box's chi-square type asymptotic expansion of Wilks' Lambda distribution is derived. It is compared with an error bound for the high-dimensional Edgeworth expansion. ... Convergence of Multinomial Goodness-of-fit Statistics to Chi-square Distribution. ...

Еще в разделе: (Показать все результаты (>83) - new.math.msu.su/ )

• http://new.math.msu.su/department/probab/bsk11_13.htm
• http://new.math.msu.su/department/probab/bsk10_14.htm
• Olympiads

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... The US Banking Policy and Its Results: The First 100 years of Experiments, . ... Ezhegodnik (Economic Hystory. ... Under the situation of the banking expansion the new National banks peacefully coexisted with the old private and state banks and provided the necessary financial resources for the states of different social and economic orientation. ...

Еще в разделе: (Показать все результаты (>140) - hist.msu.ru/ )

• Labour recruiting policy and the Nobel Association of Oil Producers. A Set of
• Moscow State University. Faculty of History. An Application

... N. Konev, D. N. Matorin, R. Hapter, and A. B. Rubin Moscow State University, Moscow, Russia Received February 12, 1998; in final form, November 18, 1998 Abstract--Vertical profiles of phytoplankton primary production (PP), chlorophyll a, and fluorescence measured near the surface in the central Baltic Sea in September 1995 featured similar variations related to the diurnal dynamics of solar radiation. ... Vertical profiles of the measured and calculated values of primary production. ...

Еще в разделе: (Показать все результаты (>38) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/matorin/3414.pdf
• http://library.biophys.msu.ru/matorin/3404.pdf
• http://library.biophys.msu.ru/matorin/3407.pdf

... Version 2.0 modifies version 1.8 to include explicit statistical estimates for similarity scores based on the extreme value distribution. ... TFASTA with ktup=2 is about as fast as a DNA FASTA with ktup=4, and is substantially more sensitive. (also reads the GENBANK library) TFASTX Search DNA library for a protein sequence by translating the DNA sequence to protein in all six frames (three forward frames with the -3 command line option) calculating similarity scores that allow frameshifts. ...

Еще в разделе: (Показать все результаты (>209) - www.genebee.msu.ru/ )

• Selected Scientific Journals - Search Engines
• OUTPUT
• GeneBee

... Scientific laboratories . ... Contact information . ... nazarov@cs.msu.ru . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty, room 586 . ... Introduction to mathematical analysis of financial instruments by Dr. Doynikov, 32 lecture hours, 7th semester. ... The Laboratory operates a range of special courses in mathematical finance, including ?Introduction to mathematical analysis of financial instruments? and ?Mathematical models of financial instruments?. ...

Еще в разделе: (Показать все результаты (>138) - en.cs.msu.ru/ )

• Department of Mathematical Cybernetics | CMC MSU
• Department of System Programming | CMC MSU
• Department of System Programming

... sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial ARTICLE IN PRESS JOURNAL OF SOUND AND VIBRATION Journal of Sound and Vibration 298 (2006) 471 - 474 www.elsevier.com/locate/jsvi Short Communication Wolfhard Kliema, Alexei A. Mailybaevb,Г, Christian Pommer a copy Conditions revisited for asymptotic stability of pervasive damped linear ... In the case of an indefinite damping matrix, system (1) may be stable or unstable. ...

Еще в разделе: (Показать все результаты (>31) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/papers/mailybaevseyranian2008.pdf
• Book review by Professor Wolfhard Kliem
• Book review by Professor Teodor M. Atanackovic

New Series of Historical Publications from the MSU Press . In 1998, the History Faculty of Moscow State University inaugurated a new series of publications designed to promote the results of recent research efforts and the teaching experience of our Faculty members and Departments. It is our intention that with these editions a clearer understanding of the Faculty, its current research orientations and mission, may be communicated. ... New Series of Editions . ...

Еще в разделе: (Показать все результаты (>6) - www.hist.msu.ru/ )

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Technical >> Development (Archive) . ... Anarchy results in order . ...

Еще в разделе: (Показать все результаты (>2848) - www.snto-msu.net/ )

• MT-32 и досбокс - Public forum of MSU united student networks
• Продам 2 планки DDR2 PC6400 1GB Samsung original - Public forum of MSU united
• [продам] Кофе зерновой Paulig Espresso Originale, 1кг - Public forum of MSU

... Web portal on atmospheric environment is developed by international consortium as a be-lingual information resource in area of atmospheric physics and chemistry and in related domain air quality assessment and management. ... The portal has all typical component and services like collections of links, user group registration, discussion forum, etc. ... Each scientific site is an information-computational system designed in Internet technologies. ... 00189 138. ... 2003 . ... 2002, 252 . ...

Еще в разделе: (Показать все результаты (>9) - geophys.srcc.msu.ru/ )

• http://geophys.srcc.msu.ru/library/parcfd2003.pdf

... The luminescence time dependence for two types of core/shell QDs (CdSe/CdS and CdTe/CdSe ) were investigated and were compared with behavior of naked ones (CdSe). ... Three different types of QDs were used in this work: simple core CdSe QDs, core/shell CdSe/CdS QDs and type II core/shell CdTe/CdSe heterostructures in charge carrier division regime (Fig.1). ... So core/shell nanocrystals demonstrate intermediate behavior between CdSe core-type QDs and CdTe/CdSe core/shell heterostructures. ...

Еще в разделе: (Показать все результаты (>129) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and
• The Laboratory of chemistry and physics of sensor and semiconductor materials |
• Лаборатория химии и физики полупроводниковых и сенсорных материалов

... The experimental data obtained using Cherenkov light of EAS reflected from the snow surface of the Big Alma-Ata Lake (Kazakhstan) are presented. ... The balloon-borne measurements in the energy range 10 15 -10 20 eV are planned. ... SPHERE detector array was elaborated for balloon-borne experiment [3-5]. ... SPHERE detector was situated on the 160 m high mountain ledge nearby the B.Alma-Ata lake (2500 m above sea level) to detect Cherenkov light reflected from the snow surface of the lake. ...

Еще в разделе: (Показать все результаты (>3) - sphere.sinp.msu.ru/ )

... All rights reserved 0301-5629/98/$­see front matter PII S0301-5629(98)00110-0 Original Contribution SHEAR WAVE ELASTICITY IMAGING : A NEW ULTRASONIC TECHNOLOGY OF MEDICAL DIAGNOSTICS A RMEN P. SARVAZYAN,* OLEG V. RUDENKO, SCOTT D. SWANSON, J. BRIAN F and STANISLAV ... Engineering Department, University of Michigan, Ann Arbor, MI (Received 5 September 1997; in final form 2 July 1998) Abstract-- Shear wave elasticity imaging ( ... Schematic presentation of shear wave elasticity imaging....

Еще в разделе: (Показать все результаты (>50) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/gordienko_files/localization_eng.pdf
• http://acoustics.phys.msu.su/teachers/lecture/matmodel.pdf

... Экспериментальное исследование интенсификации теплообмена (соотношение между теплообменом и сопротивлением) на "вихреобразующих" (лунки, выступы и т.п.) поверхностях . при сверхзвуковых скоростях набегающего потока . при дозвуковых скоросях набегающего потока . Исследование эффективности тепловой защиты при вдуве охлаждающего газа через пористые поверхности ("пористое" охлаждение) . Газодинамическая температурная стратификация (безмашинное температурное разделение) потоков. ...

Еще в разделе: (Показать все результаты (>12) - termogaz.imec.msu.ru/ )

• scientific results_e
• supersonic dimples_e
• Numeric_e

Proceedings of ICHIT- 06 26 February - 5 March 2006, Moscow, Russia LINEAR AND NONLINEAR ANALYSIS OF NUMERICAL METHOD FOR DNS OF TURBULENT CONVECTION IGOR B. PALYMSKIY Modern Academy for Humanities, Novosibirsk Branch , Novosibirsk, Russia, 630064 palymsky@hnet.ru Abstract We study the spectral characteristics of the numerical method for DNS of turbulent convectional flows. ... So far the full numerical simulation of 3-D turbulent convection is very complex problem demanding the large resources. ...

Еще в разделе: (Показать все результаты (>26) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2006/CD/Palymskiy2.pdf
• http://hit-conf.imec.msu.ru/2012/abstracts/Kurbatsky.doc
• http://hit-conf.imec.msu.ru/2006/CD/Palymskiy1.doc

Marketing Plan Outline Canada Business Service Centres - CBSCs Last Verified: 2004-11-08 Document No. 4014 Summary A marketing plan is designed to direct company activities towards the satisfaction of customer needs; determine what the customer wants, develop a product/service to meet those needs, get the product/service to the end user and communicate with the customer - at a profit! ... levels, sales volumes? ... What is the consumer acceptance price range for this type of product/service? ...

Еще в разделе: (Показать все результаты (>70) - innovation.msu.ru/ )

• http://www.innovation.msu.ru/english/reportofinvention.doc
• http://www.innovation.msu.ru/english/neuromotioncasestudy.doc

... Форумы > Аспирантура > Тема . ... Research assistant in a world leading research lab in digital music/audio . Work closely related to Audio/Music/Multimedia in a Spanish Research Lab. ... Other advantages include a fairly flexible working hours, team from all over the world, and working in _the leading_ reseach lab in the digital audio/music research lab. ... You will help a team of researchers by architecting, designing, developing and testing functional music and audio content retrieval systems. ...

Еще в разделе: (Показать все результаты (>136) - www.mmonline.ru/ )

• Математический семинар Глобус 17 июня

... In this article, the light propagation in a diffuser with optically soft inclusions is described with the help of the Fokker­Planck equation, i.e., a transfer equation with a diffusion term in the space of radiation-propagation directions. The coefficient of angle diffusion is calculated using the Mie theory. The equation is solved numerically using the stochastic analog method, and the space and angle distribution of the radiation that passed through the diffuser is calculated. ...

Еще в разделе: (Показать все результаты (>16) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/sust-2003-17-443.pdf
• http://lizard.phys.msu.su/home/science/Masyukov-Dmitriev-11-JAP-InN.pdf
• http://lizard.phys.msu.su/home/science/Masyukov-Dmitriev-11-JMathSci-InN.pdf