... Key words: Mathematical physics, algebraic geometry, quantum groups. ... Major research position at the Higher geometry and topology department of MSU(from 2009) Doctor habilitatus degree in physical-mathematical sciences Адрес: 119991 ГСП-1, г. Москва, Ленинские горы, МГУ, механико-математический факультет, кафедра высшей геометрии и топологии e-mail: dtalalaev@yandex.ru тел: (495) 939 3798 Текущие научные проекты: Семинар по некоммутативной геометрии (ИТЭФ). ... Семинар ИТЭФ . Семинар МГУ . ...
Oceanology, Vol. ... MARINE BIOLOGY A Comparative Study of the Primary Production in the Norwegian Sea by Different Methods V. V. Sapozhnikov*, V. B. Goryunova*, B. A. Levenko**, L. E. Dulova***, T. K. Antal**, and D. N. Matorin** * All-Russia Research ... Microbiology, Russian Academy of Sciences, Moscow, Russia Received December 1, 1998; in final form, March 1, 1999 Abstract--The results of primary production measurements obtained by different methods are presented ... OCEANOLOGY Vol. ...
. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the
... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...
International Journal of Inorganic Materials 1 ( 1999 ) 201 207 Approximation of Mulliken charges for the silicon atoms of all-siliceous zeolites q 1 A.V. Larin , D.P. Vercauteren* ґ Institute for Studies in Interface Sciences, Laboratoire de Physico-Chimie Informatique, Facultes ... In this paper, we will discuss several approximations of the Mulliken charges for the zeolite silicon atoms calculated with the same basis sets as already used previously for oxygen [7]. ...
... You must have cookies enabled to log in to MediaWiki. ... Retrieved from " http://algcourse.cs.msu.su/teachwiki/index.php/Special:UserLogin " . Special page . 93.180.27.85 . Talk for this IP address . Log in . ... 1-й семестр 2015 г. Материалы по системе ejudge . ... Special pages . ... About MediaWiki . ...
HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...
Sternberg astronomical institute activities on site testing programs review Victor Kornilov comprehensive/characterization/of/astronomical/sites > kislovodsk/russia/2010/october/4-9 > Introduction This presentation responds on our activity in 5 last years only, inspite of that in SAI site testing researches have been started many years ago. ... More detailed discussion is devoted to MASS and DIMM measurements processing, some additional effects which were taken in account in last year. ...
[
Текст
]
Ссылки http://site2010.sai.msu.ru/static/doc/VKornilov_site2010.pdf -- 2488.3 Кб -- 18.10.2010 Похожие документы
Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_realtime/papers/balashov_et_al_eucass2011_monitoring.doc -- 194.5 Кб -- 27.05.2015 Похожие документы
... It is being organized jointly by the Byurakan Astrophysical Observatory (BAO) and the Armenian Astronomical Society (ArAS). ... LIST OF LECTURERS AND LECTURES : Dr. Vladimir AIRAPETIAN (Goddard Space Flight Center, USA): Physics of Winds from Cool Evolved Stars Dr. Don BARRY (Cornell University ... (observation techniques and theory) Dr. Michel DENNEFELD (Institut d'Astrophysique de Paris, France): Introduction to spectroscopic observations Dr. Serguei DODONOV (Special Astrophysical ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...
... Preliminary evaluation of forest ecosystems' state near the smelter was made, the monitoring methodology for polluted areas was developed, and critical loads of acid deposition were assessed (see also soil.msu.ru/projects/acidification/ ). ... The new built up database on forest ecosystem data for permanent monitoring plots was used for analysis of soil chemical state in forest ecosystems subjected to airborne pollution in the fragile boreal environment in the Norwegian-Russian border area. ...
... B Dispatch: 30.1.04 Author Received: Journal: JEB CE: Kumar No. of pages: 12 PE: Sri doi:10.1111/j.1420-9101.2004.00705.x Human birthweight evolution across contrasting environments F. T H OMAS , * A . ... The model illustrates that optimal birthweight depends on which fitness-reducing risk locally predominates (somatic diseases, parasitic diseases or adverse environmental conditions). ... Growth in utero, blood pressure in childhood and adult life, and mortality from cardiovascular disease. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf -- 284.1 Кб -- 16.03.2009 Похожие документы
... The latter should be taken into account and carefully modeled as a fluid-structure interaction (FSI) problem. A patient- specific FSI analysis is impossible because it predicts only estimated hemodynamic features which are based on assumptions regarding material properties. The objective of this study is to develop a new methodology that assimilates medical imaging data for quantitative hemodynamic data extraction. ...
[
Текст
]
Ссылки http://hit-conf.imec.msu.ru/2012/lectures/Yakhot-abstract.doc -- 21.5 Кб -- 14.06.2015 Похожие документы
. Евгений Вареник, 28 февраля 2006 . Схема Горнера вычисления значения полинома в точке. Доказательство ее оптимальности в худшем случае по числу операций "сложение" и "умножение" среди алгоритмов, использующих только эти операции. Материалы к докладу: . E.M. Reingold and A.I. Stokes, Simple proofs of lower bounds for polynomial evaluation, in: R.E. Miller and J.W. Thatcher, Eds., Complexity of Computer Computations (Plenum, New York, 1972) 21--29.
... О кафедре . ... Научная работа . ... Главная Научная работа Математические модели взаимодействия элементарных и структурированных объектов . ... Ведущий научный сотрудник Эльтеков В.А. В разное время в состав группы входили: Н.Н.Шапошников, А.В.Овсянкин, В.Б.Шикалов, Н.Г.Васичкина (кафедра математики), Л.П.Развина, О.В.Попова, Н.Н.Негребецкая (кафедра физической электроники), В.Н.Самойлов, Н.Г.Ананьева (кафедра общей физики). ... Кафедра математики физического факультета МГУ им. М.В. Ломоносова . ...
http ://www.cbat.eps.harvard.edu/iau/cbet/003900/CBET003962.txt Electronic Telegram No.3962 Central Bureau for Astronomical Telegrams INTERNATIONAL ASTRONOMICAL UNION CBAT Director: Daniel W. E. Green; Hoffman Lab 209; Harvard University ; 20 Oxford St.; Cambridge, MA 02138; U.S.A. e-mail: cbatiau en eps.harvard.edu (alternate cbat en iau.org) URL http ://www.cbat.eps.harvard.edu/index.html Prepared using the Tamkin Foundation Computer Network SUPERNOVA ...
... Continental Lithosphere Beneath SE Brazil . ... CREST (Continental Rifts: Evolution, Structure and Tectonics) Project . Crust and Upper Mantle Structure of S. California . ... Surface wave dispersion and upper mantle structure beneath southern Germany . ... Tomographic P-wave velocity inversion for the crust and upper mantle structure beneath Alaska . ... Upper Mantle Velocity and Q Structure . ... Velocity structure and anisotropy of the crust and upper mantle in the Brooks Range, Alaska . ...
... Algorithm & . Format requirements . ... SDPsite is a tool for identification of protein active and other functional sites, based on spatial clustering of SDPs (specificity-determining positions, described here ) with CPs (conserved positions). ... Mapping predictied positions onto structure and construction of the best cluster . ... The input data of the algorithm are a multiple protein alignment divided into specificity groups . ... is called statistical significance of the set of k* positions . ...