... It is being organized jointly by the Byurakan Astrophysical Observatory (BAO) and the Armenian Astronomical Society (ArAS). ... LIST OF LECTURERS AND LECTURES : Dr. Vladimir AIRAPETIAN (Goddard Space Flight Center, USA): Physics of Winds from Cool Evolved Stars Dr. Don BARRY (Cornell University ... (observation techniques and theory) Dr. Michel DENNEFELD (Institut d'Astrophysique de Paris, France): Introduction to spectroscopic observations Dr. Serguei DODONOV (Special Astrophysical ...
... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...
системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи,базы данных, информационные технологии,технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование,математическое моделирование, вычислительный эксперимент, информатика,методы вычислений, численный анализ, numerical ...
... In this article, the light propagation in a diffuser with optically soft inclusions is described with the help of the FokkerPlanck equation, i.e., a transfer equation with a diffusion term in the space of radiation-propagation directions. The coefficient of angle diffusion is calculated using the Mie theory. The equation is solved numerically using the stochastic analog method, and the space and angle distribution of the radiation that passed through the diffuser is calculated. ...
[
Текст
]
Ссылки http://lizard.phys.msu.su/home/science/Dmitriev-Ivanov-Xoxlov-11-JMathSci-Diffuser.pdf -- 359.0 Кб -- 10.02.2011 Похожие документы
Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Для их эффективного использования не достаточно широко распространенных языков высокого уровня, необходимы языки программирования, позволяющие использовать все предоставляемые производителем ресурсы. ... VHDL (Very high speed integrated circuits Hardware Description Language) - язык описания аппаратуры высокоскоростных интегральных схем. ... Verilog - это язык описания аппаратуры, используемый для описания и моделирования электронных систем. ... Особенности языков описания архитектуры Verilog и VHDL...
... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...
NEMO Mini-Tower Floor Simulation construction Normalized Value X 'V X= N V volume N number of decays X' number of coincidence Simulation results Data packet P ack et s r o w P ack et s r o w Experimental data processing Experimental data processing Coincidence rate PMT_IDs 1-2 3-4 5-6 7-8 9-10 11-12 13-14 15-16 Coincidence ...
О кафедре . ... Наглядная и компью терная геометрия и топология . ... Г.В.Носовский. ... Математические заметки, т. 33, вып. 2, 1985, с. 325-333. ... Об условиях, возникающих при оценке производных решений стохастических дифференциальных уравнений в римановых пространствах.. ... Тезисы Бакинской международной конференции по топологии и ее приложениям. ... В.В.Калашников, Г.В.Носовский, А.Т.Фоменко. ... Г.В.Носовский, А.Т.Фоменко. ... Вып. ... А.А.Голованов, Д.П.Ильютко, Г.В.Носовский, А.Т.Фоменко. ...
About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...
... Инновационная . структура МГУ . ... Обучение инновационному менеджменту . ... Нормативно-правовая база инновационной . деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... Building on the objectives of your current business plan, you schedule a comprehensive series of promotional activities for your company. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...
... Human pro-B-type natriuretic peptide is processed in the circulation in a rat model. ... BACKGROUND: The appearance of B-type natriuretic peptide (BNP) in the blood is ultimately caused by proteolytic processing of its precursor, proBNP. ... RESULTS: ProBNP was effectively processed in the circulation into BNP (1-32) and various truncated BNP forms as confirmed by gel filtration and MS analysis. ... CONCLUSIONS: In rats, processing of human proBNP to active BNP occurs in the circulation. ...
Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . Prof. Dr. Olga I. Vinogradova . Moscow State University . ... Research . ... Professor, Director of Laboratory . ... Type of research: . ... She then joined the group of Prof. Boris V. Derjaguin at the Laboratory of Physical Chemistry of Modified Surfaces, part of the A.N.Frumkin Institute of Physical Chemistry and Electrochemistry (Russian Academy of Sciences) as a research fellow. ...
... It carries out the basic communication op erations, such as b oundary exchanges and transp ositions of decomp osed data. ... Data distribution b efore transp osition. б б бвб бв б б б бвбв б бв б бвбв б б б б б бвбв б бв б бвбв б б бвб бв б б б бвбв б б бвбв б б б б б бвбв б бв б бвбв б б бвб бв б б б бвб бв б б б бвб бв б б б бвб бв б б б б бвбв б бв бвбв б бв бвбв б бв бвбв б бв бвбв б бв б бвбв б б бвб бв б б б бвб бв б б б бвб бв б б б ...