... Education" Interdisciplinary Conference will take place in Dubna, Russia on January 28 ґ February 2, 2008 th Lomonosov Moscow State University Joint Institute for Nuclear Research Pushchino Scientific Center Organizing Committee Galina Yu. Riznichenko Lomonosov Moscow State University Rudolf Pose Joint Institute for Nuclear Research Vladislav M. Komarov Biophysics Institute of Cell, Russian Academy of Sciences Mathematics is a well-known language that unites contemporary science. ...

Еще в разделе: (Показать все результаты (>494) - www.mce.biophys.msu.ru/ )

• http://www.mce.biophys.msu.ru/archive/doc97210/eng.pdf
• http://www.mce.biophys.msu.ru/files/mce14eng.pdf
• http://www.mce.biophys.msu.ru/archive/doc31852/eng.pdf

Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>3) - seyranian.imec.msu.ru/ )

... BUSINESS ADDRESSES: Physics Department, Moscow State University, . ... Research Assistant, Department of Chemistry, Moscow State University, 1971-1972 . ... Research Associate, Physics Department, Moscow State University, 1972-1984 . ... Senior Scientist, Physics Department, Moscow State University, 1984-1991 . ... Associate Professor, Physics Department, Moscow State University, 1991-2002 . ... Professor, Physics Department, Moscow State University, Since 2002 ? present HONORS and PRIZES . ...

Еще в разделе: (Показать все результаты (>49) - shg.phys.msu.ru/ )

• TATIANA VLADIMIROVNA MURZINA
• Nick's Homepage

. N.N.Bogoliubov Institute for Theoretical Problems of Microphysics . M.V.Lomonosov Moscow State University . Choose encoding: . The URL for ITPM MSU Web Page is http://itpm.msu.su . If you have remarks or suggestions please send your comments to . (C) Copyright ITPM MSU 1997, 1998, 1999

Еще в разделе: (Показать все результаты (>136) - itpm.msu.su/ )

• Links
• partform.html

Sergey Vladimirovich Petrushanko Afflilation and official address: Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow State University Leninskiye Gory, Moscow 119991, Russia E-mail: sergeant@mail.cern.ch Date and place of Birth: 24 March 1975, Sverdlovsk (USSR) Citizenship: Russian Federation Education: 2002 Ph.D. (High energy physics ) Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow ...

Еще в разделе: (Показать все результаты (>126) - lav01.sinp.msu.ru/ )

• Vladimir L. Korotkikh
• Home Page of A. Snigirev
• History of Strong Interactions Laboratory

... Data . ... MIR Station . ... Mir was the world's first consistently inhabited long-term research station in space, and the first 'third generation' type space station, constructed over a number of years with a modular design. ... Detectors of the instrument package allow observing fluxes of >0.1 MeV gamma-quants associated with bremstrahlung emission of high energy electrons of similar energies and with integral fluxes of high energy electrons (>5 MeV) and protons (>60 MeV). ... 60 MeV). ...

Еще в разделе: (Показать все результаты (>68) - smdc.sinp.msu.ru/ )

• Home - Space monitoring data center
• Space monitoring data center Space monitoring data center - mission
• Coronas-I - Space monitoring data center

MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...

Еще в разделе: (Показать все результаты (>97) - brain.bio.msu.ru/ )

• Sergei Shishkin * Сергей Шишкин
• S.Borisov
• Alexander Zhigalov

МОСКОВСКИЙ . ГОСУДАРСТВЕННЫЙ . УНИВЕРСИТЕТ . имени . М.В.ЛОМОНОСОВА . ... ФАКУЛЬТЕТ . ... МАТЕМАТИЧЕСКОЙ ФИЗИКИ . ... Московский государственный университет . имени М.В.Ломоносова (факультет ВМК) . ... университет имени М.В.Ломоносова факультет ВМК . ... федеральное государственное бюджетное образовательное учреждение высшего образования 'Московский государственный университет имени М.В.Ломоносова' ОГРН: 1037700258694 . ... МГУ имени М.В.Ломоносова (Факультет ВМК ) . ...

Еще в разделе: (Показать все результаты (>55) - mph.cmc.msu.ru/ )

... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>19) - qsar.chem.msu.ru/ )

• Palyulin, Vladimir A. - Laboratory of Medicinal Chemistry
• Orlov, Alexey A. - Laboratory of Medicinal Chemistry
• Voronkov, Andrew E. - Laboratory of Medicinal Chemistry

Вы посетили: autobio_engl.html . ... 1998: Student at the Moscow State University, Department of Mathematics and Mechanics . ... Degree, Moscow State University . ... 2001: Ph.D. student at the Moscow State University, Department of Mathematics and Mechanics, Faculty of Algebra . ... 2007: Assistant professor at the Moscow State University, Department of Mathematics and Mechanics, Faculty of Algebra . ... staff/guterman/autobio_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>21) - halgebra.math.msu.su/ )

• staff:guterman:englver.html | Кафедра высшей алгебры

... Personal Data 1.1 1.2 1.3 1.4 1.6 1.8 1.9 Name First Name Other Names (//) Date of Birth (d/m/y) Place of Birth Passport (//) Passport issued (d/m/y) / , / / 1.5 1.7 Sex Citizenship M/M /F / 1.10 valid till / / 2. ... Sending Institution 4.1 4.2 4.3 Ti t l e Faculty / Year / Program / Undergraduate Student / Bachelor course / PhD Student / Other: / Master course 5. Language Skills1 5.1 5.2 5.3 5.4 Russian English Other Necessity for Russian Courses at MSU Certificate to be presented 1 , . ...

Еще в разделе: (Показать все результаты (>188) - www.ied.msu.ru/ )

• International Office of Moscow University - Home
• International Office of Moscow University - Welcome by the Rector
• International Office of Moscow University - Programs and degrees

... Staff and contacts . ... Irina Naletova CV . ... Address: Laboratory of Animal Cell Biochemistry, A.N. Belozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University, 119992, Moscow, Russia . ... 2005 present time a Research Fellow in Laboratory of Animal Cell Biochemistry (head Prof. Vladimir Muronetz ) of A.N. Belozersky Institute of Physico-Chemical Biology, Lomonosov Moscow State University . ... Department of Animal Cell Biochemistry . ... Staff and Contacts . ...

Еще в разделе: (Показать все результаты (>2508) - kodomo.cmm.msu.ru/ )

• Changeset 69:ac96d7c2c7c4 ? Cyclyc Cell Automata
• Cyclic cellular automata
• Term 2

Moscow State Lomonosov University and Moscow Mathematical Society . ... Topology, analysis and applications to mathematical physics" . ... Geometry and topology, analysis, applications to mathematical physics . ... Moscow Mathematical Society, . ... Seminar on Topology and Analysis . ... Do you need an accomodation in Moscow: Yes No . Do you need a visa support: Yes No . If YES where do you intend to apply for the Russian Visa? ... to Organizing Committee by October 23, 2004 at the latest. ...

Еще в разделе: (Показать все результаты (>60) - dfgm.math.msu.su/ )

• 1st Announcement
• Intro
• List of participants

Yakubovich (i) Professional preparation Olga Yakubovich 1967 ґ 1973 1973 ґ 1978 1996 (ii) Appointments MS in Geochemistry (cum laude), Moscow State University , Russia PhD in Crystallography and Crystal physics, Moscow State University , Russia Dr of Science in Geology and Mineralogy, Moscow State University , Russia 1997 ґ present 1994 ґ 1997 1983 ґ 1994 1973 - 1983 Department of ...

Еще в разделе: (Показать все результаты (>54) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/staff/elbel.php
• http://cryst.geol.msu.ru/en/

Sergei Kulik . ... Department of Quantum Electronics, Faculty of Physics, M.V.Lomonosov Moscow State University, Leninskie gory, 1, str.2, Moscow 119992, GSP-2, Russia, . ... 1986 Graduated from M.V.Lomonosov Moscow State University; . 1991 Ph.D. in M.V.Lomonosov Moscow State University; . ... 2006 - M.V.Lomonosov Moscow State University, . Department of Quantum Electronics, Faculty of Physics, Head of Quantum Information lab . 2003 - M.V.Lomonosov Moscow State University, . ...

Еще в разделе: (Показать все результаты (>115) - qi.phys.msu.ru/ )

• Sergei Kulik: List of major publications
• Directions :: Quantum Information Laboratory
• PUBLIC

... School of Public Administration . Lomonosov Moscow State University . ... Moderator: Prof. V.A.Nikonov, Dean, School of Public Administration, Lomonosov Moscow State University . ... Chairperson: Prof. A.I. Solovyov, School of Public Administration, Lomonosov Moscow State University . ... Chairperson: Prof. A.V. Surin, School of Public Administration, Lomonosov Moscow State University . ... Chairperson: Prof. V.G. Koshkidko, School of Public Administration, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>81) - www.spa.msu.ru/ )

• The 14th International Conference 'Public Administration of the Russian
• Visa Support Information

. Bulk of the information is in the Russian version . Go there if you can read Russian . General Information . Personalia . Science and Publications . Uralian Expedition . Crimean Student Practice . Uralian Student Practice . Software , Miscelaneous Informationx . Photoalbums . Address any question to and@geol.msu.ru

Еще в разделе: (Показать все результаты (>50) - sbmg.geol.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... M.V.Lomonosov Moscow State University . ... Junior Scientific Researcher, Senior Scientific Researcher, Leading Scientific Researcher, Department of Inorganic Chemistry, Chemistry Faculty of Lomonosov Moscow State University . ... Head of the Inorganic Crystal Chemistry Laboratory, Department of Inorganic Chemistry, Chemistry Faculty of Lomonosov Moscow State University . ... Professor of the Department of Inorganic Chemistry, Chemistry Faculty of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>144) - electr003.chem.msu.ru/ )

• Victor A. Safonov:CV
• Galina A. Tsirlina:CV
• Boris I. Podlovchenko:CV

... The traditional answer to this question is unequivocal: тАЬno, public scholarship cannot and should not exist.тАЭ To popularize knowledge is to simplify, and simplification risks the loss of nuance and complexity, the very essence of scholarly knowledge. ... The public sphere can know but a distorted version of scholarly knowledge. ... You need JavaScript enabled to view it. (with Summer School-2016 in the subject line) before April 25, 2016. ... Summer School Archives . ...

Еще в разделе: (Показать все результаты (>10) - discours.philol.msu.ru/ )

• Contact us
• Anna Kotomina
• Free verse and free dance