... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

... subject to AIP license or copyright; see http://jap.aip.org/about/rights_and_permissions JOURNAL OF APPLIED PHYSICS 111, 07A944 ( 2012 ) Femtosecond time -resolved Faraday rotation in thin magnetic films and magnetophotonic crystals A. V. Chetvertukhin, M. I. Sharipova, A. G. Zhdanov, T. B. Shapaeva, T. V. Dolgova, and A. A ... Figure 3 shows calculated femtosecond dynamics of Faraday angle in thin film as a function of central wavelength of a 130-fs pulse in the range from 1500 to 1550 nm....

Еще в разделе: (Показать все результаты (>83) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/jap111_07a948_2012.pdf
• http://nanolab.phys.msu.ru/sites/default/files/romodina_et_al-2015-direct_measurements_of_magnetic_interaction-induced_cross-correlations_of_two.pdf
• http://nanolab.phys.msu.ru/sites/default/files/8458-29.pdf

... Research objects and scientific purposes . Space scientific program includes development and launch of two supersmall spacecrafts "Universitetskiy" and "Kompas-2" intended for monitoring of radiation conditions near the Earth. ... All the studies conducted in the near-Earth space are characterised by strong radiation fields. ... The circular polar orbits, which cover all the near-Earth space, are the most favorable for comprehensive studies of the radiation conditions near the Earth. ...

Еще в разделе: (Показать все результаты (>65) - cosmos.msu.ru/ )

• University Satellites and Space Science Education '2006

... 13-Aug-2014 12:13 106K lk_20140815_0905.tar.. 15-Aug-2014 09:06 106K lk_20140901_0823.tar.. 01-Sep-2014 08:23 103K lk_20141016_1324.tar.. 16-Oct-2014 13:25 103K lk_20141211_1708.tar.. 11-Dec-2014 17:08 103K lk_20150430_0315.tar.. 30-Apr-2015 03:15 103K lk_20150430_0420.tar.. 30-Apr-2015 04:20 103K lk_20150818_1511.tar.. 18-Aug-2015 15:11 104K lk_20151113_1903.tar.. 13-Nov-2015 19:04 105K lk_20160314_0610.tar.. 14-Mar-2016 06:11 105K . ...

Еще в разделе: (Показать все результаты (>4) - scan.sai.msu.ru/ )

Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>10) - lmmqsp.sinp.msu.ru/ )

... Miklukho-Maklaya 16/10, Moscow, 117997, Russia, +7(495)3366455, alexei@nmr.ru . ... Analysis of PS microdistribution in tissues as a function of time after PS injection (topical or oral application) helps to characterize a selectivity of PS accumulation in tumor cells and other tissue structures; to reveal correctly a maximum of time profile of its tumor accumulation and to recognize the features of PS tissue distribution (spatial and temporal) at different ways of PS application. ...

Еще в разделе: (Показать все результаты (>117) - www.msm.biophys.msu.ru/ )

... The factors that play the key role in complex formation are as follows: the rate of protein diffusion to the docking site; long-range electrostatic interactions between protein surfaces, geometric and chemical complementarity of binding areas; molecular mobility at the protein­protein interphase, hydrogen bonds, Van der Waals interactions, hydrophobic interactions, and salt bridges. ... Three-dimensional protein molecules are constructed on the basis of data extracted from the Protein Data Bank. ...

Еще в разделе: (Показать все результаты (>40) - www.library.biophys.msu.ru/ )

• МОДЕЛИРОВАНИЕ ВЗАИМОДЕЙСТВИЯ МАГНИТНОГО ПОЛЯ С ОБЪЕМНЫМИ ВЯЗАНЫМИ СТРУКТУРАМИ

... An Analysis of Modern Discrete Movements of the Earth's Crustal Blocks in Geodynamically Active Regions Based on GPS Data V. S. Zakharov and D. A. Simonov Moscow State University, Moscow, 119991 Russia e mail: zakharov@dynamo.geol.msu.ru; simon@geol.msu.ru Received March 24, 2009 Abstract--In this work original algorithms are proposed that allow us to provide a set of points (clusters) on a surface that are in cooperative motion, on the basis of an analysis of GPS data. ... Method O1. ...

Еще в разделе: (Показать все результаты (>28) - dynamo.geol.msu.ru/ )

• Summaries of articles

... For the past years I have been working on the problem of synthesis of light curves of close binary systems, consisting of a normal star and a compact object (point object with fixed X-ray luminosity). ... Possible existence of a bright spot on the disk's lateral surface is taken into account. ... The last of then will be published in Gordon and Breach Publishers ( Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ... Cherepashchuk A.M., Katysheva N.A., Khruzina T.S., Shugarov S.Yu. ...

Еще в разделе: (Показать все результаты (>17) - uranus.sai.msu.ru/ )

• MERLAN
• Anatol Cherepashchuk
• Igor Antokhin