General Information . ... The conference is organized by the Sternberg Astronomical Institute (SAI) of Moscow University and the IAU Working group "Site-testing Instruments" . ... Use of site data in telescope operation and adaptive optics. ... Recent conferences on this subject (2007, 2008) demonstrated great interest of the community, hence the need for a new meeting. ... Unlike previous recent conferences, this meeting will cover all aspects of site monitoring for optical/IR astronomy. ...

Еще в разделе: (Показать все результаты (>216) - site2010.sai.msu.ru/ )

... Download NPG-explorer . ... Build nucleotide pangenome . ... Here we provide a table for 3 Brucella genomes: all: embl :CP002459 BRUMM chr1 c Brucella melitensis M28 chromosome 1 all: embl :CP002460 BRUMM chr2 c Brucella melitensis M28 chromosome 2 all: embl :CP003176 BRUAO chr1 c Brucella abortus A13334 chromosome 1 all: embl :CP003177 BRUAO chr2 c Brucella abortus A13334 chromosome 2 all: embl :CP002078 BRUPB chr1 c Brucella pinnipedialis B2/94 chromosome 1 all: ... Fix bugs....

Еще в разделе: (Показать все результаты (>3) - mouse.belozersky.msu.ru/ )

4 SPIN. ... 0 1 Hello, world! ( ) ";" , active proctype main() { printf("Hello, world!\n") } ­ , >spin hello.pml Hello, world! 1 process created Hello, world! ... mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( turn == P) - printf( Produce\n ); turn = C od } active proctype consumer() { do :: ( turn == C) - printf( Consume\n ); turn = P od } ( 1) ­ 0, (op on sequence) (guard) ­ mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( ...

Еще в разделе: (Показать все результаты (>2) - savenkov.lvk.cs.msu.su/ )

• http://savenkov.lvk.cs.msu.su/mc/lect02.pdf

... Specialist degree . ... Master degree . ... Master variants . ... About Faculty . ... Mechmath faculty admission resumed its work and is actively preparing for the new reception 2015! ... Read more about Schedule in June . ... The Dean of Mechanics and Mathematics Faculty, the head of the Department of Mathematical and Computer Analysis Methods, professor Vladimir Chubarikov ; . ... Read more about The Open Day . ... 2016 Mechmath admission for internetional students ...

Еще в разделе: (Показать все результаты (>7) - pk.math.msu.ru/ )

• information | Mechmath admission for internetional students
• IX Festival of Science | Mechmath admission for internetional students

... История курсов . ... close this panel . ... Выпускной класс . Старшие классы . Младшие классы . ... Прием на курсы . ... График мероприятий . ... Телефоны, адреса . График работы . ... Приветствуем вас на сайте Общеуниверситетских подготовительных курсов.љ ... Обращаясь на курсы через форму "Задать вопрос", будьте внимательны при написании своего электронного адреса.љ . ... Сайт общеуниверситетских . подготовительных курсовљ . ...

Еще в разделе: (Показать все результаты (>4) - oupk.msu.ru/ )

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>4) - sinp.msu.ru/ )

... M.V.Lomonosov Moscow State University . ... Physicists from Lomonosov Moscow State University studied the dynamics of multiple cavitation bubbles excited by a fs laser superfilament and developed a new approach for their control by laser pulse energy and external focusing. For the first time an innovative method of controlling the dynamics of cavitation bubbles excited by the distributed laser-plasma source (filament) was demonstrated. ... 119991, Moscow, . ...

Еще в разделе: (Показать все результаты (>63) - phys.msu.ru/ )

... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...

Еще в разделе: (Показать все результаты (>7) - ferro.phys.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ­ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf

PHYSICAL REVIEW A, VOLUME 61, 052305 Analysis of radiatively stable entanglement in a system of two dipole-interacting three-level atoms I. V. Bargatin, B. A. Grishanin, and V. N. Zadkov International Laser Center and Department of Physics, M. V. Lomonosov Moscow State University, Moscow 119899, Russia Received 29 November 1999; published 7 April 2000 We explore the possibilities of creating radiatively stable entangled states of ... II only two transitions in the whole system. ...

Еще в разделе: (Показать все результаты (>66) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/PRA22309.pdf
• http://qilab.phys.msu.ru/papers/FortschrPhys-2000-en.pdf
• http://qilab.phys.msu.ru/papers/UFN-2001-44(6)-en.pdf

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>3) - swx.sinp.msu.ru/ )

Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>108) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

RAPID COMMUNICATIONS PHYSICAL REVIEW A, VOLUME 62, 011802 R High-intensity pulsed source of space-time and polarization double-entangled photon pairs Yoon-Ho Kim,* Sergei P. Kulik, and Yanhua Shih Department of Physics, University of Maryland, Baltimore County, Baltimore, Maryland 21250 Received 4 April 2000; published 13 June 2000 Two spatially separated type-I nonlinear ... Two orthogonally oriented type-I BBO crystals are placed collinearly and pumped by 45° polarized femtosecond pulses. ...

Еще в разделе: (Показать все результаты (>128) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2006-jetp(e)-102-712.pdf
• Publications :: Quantum Information Laboratory

... Dear creators of the Bensons courses! First of all I would like to thank you for such a magnificent English course! ... Look, it's really much more interesting - to listen to a virtual book, to look through the pictures, let alone role-play! ... However, I'm very glad that I took up "Bensons" - the course has given me wonderful possibilities to learn more about English culture, to fill some gaps in my knowledge of English grammar and just to spend my time with great pleasure and benefit! ...

Еще в разделе: (Показать все результаты (>9) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр Дистанционного обучения.

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>3) - saistud.sai.msu.ru/ )

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>60) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf
• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

Communicating Through Art, L.Vershbow . ... But here I am, and as a designer, I will attempt to explain to you how I perceive art and design as a form of communication. Most of us think of art as the works that hang in museums and on the walls of our homes. ... But art, design and symbols, whether they are aesthetically pleasing or not, are all around us, and they help to guide us through the complexities of everyday society. ... Today I am a designer and creator of contemporary jewelry. ...

Еще в разделе: (Показать все результаты (>10) - suny.msu.ru/ )