Sign in Register . ... info@ecfs.msu.ru . All contacts . ... for Food Security . Home News Presentation of Global Nutrition Report . ... On 11th of February 2016, the presentation of the Global Nutrition Report will take place in Moscow for the first time. The report will be presented by the team of experts from International Food Policy Research Institute (IFPRI). headquartered in Washington DC, USA as part of the Conference on Nutrition issues in the CIS countries. ... 12 January 2016 . ...

Еще в разделе: (Показать все результаты (>36) - ecfs.msu.ru/ )

• Resources | ECFS
• Topic 2: Barriers to Sustainable Soil Management in Eurasia / Барьеры на пути к
• News | ECFS

... Popov Yu V. , Kouzakov K.A. , Bulychev A.A. , Vinitsky S.I. Theory of quasielastic atomic reactions in the presence of an alternating electric field . ... Journal of Physics B: Atomic, Molecular and Optical Physics , изд - во Institute of Physics Publishing (United Kingdom), 2 015, том 48, с . ... Kouzakov K.A. , Zaytsev S.A. , Popov Yu V. , Takahashi M. // Physical Review A - Atomic, Molecular, and Optical Physics , изд-во American Physical Society (United States) , V. 87, P. 046702-1-046702-2. ...

Еще в разделе: (Показать все результаты (>99) - danp.sinp.msu.ru/ )

... Annex (e.g. 3.1) (3) Paragraph/ Figure/Table/ Note (e.g. Table 1) 4 Type of comment2 5 Comment (justification for change) by the MB Date: (6) Document: (7) Secretariat observations on each comment submitted Proposed change by the MB RU RU RU RU 2 2 2 2 Row 2 Row 4 Row 4 Row 5 ed ed ed te SEPs are not fluxes , but particles It is desirable to add that Wolf number is also known as the sunspot number. ... CLOSED: Accepted and implemented in modified form CLOSED: Accepted and RU 2 Row 16 . ...

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

• Rikho Nymmik

... 2 (1997) 147-157 PRINCIPAL TRENDS IN MODERN ECOLOGY AND ITS MATHEMATICAL TOOLS: AN ANALYSIS OF PUBLICATIONS* E. V. BUDILOVA, J. A. DROGALINA, A. T. TERIOK.HIN Department of Biology, Moscow State University, Moscow 119899 (Russia) E-mail: lenl@ATeriokhin.home.bio.msu.ru (Received March 12, 1997) The paper deals with a scientometric analysis of publications from the journals Ecology and Ecologia (Russia) based on the ... Keywords of group С are encountered in 17% and В in 11% of papers. ...

Еще в разделе: (Показать все результаты (>29) - ecology.genebee.msu.ru/ )

... Thursday, April 19th, 2012 . ... Posted in Uncategorized | No Comments ? Friday, April 13th, 2012 . Обновлен раздел Публикации за 2011 . ... Сделать это можно использую Map Tools проекта SOPAC (http://sopac NULL .ucsd NULL .edu/maps/) . ... 17-21 октября 2011 в ИФЗ РАН прошла Вторая молодежная тектонофизическая школа-семинар (http://tph_2011 NULL .ifz NULL .ru/) , на котором наша лаборатория приняла участие. ... Лаборатория лазерной интерферометрии is proudly powered by WordPress . ...

Еще в разделе: (Показать все результаты (>46) - geo.sai.msu.ru/ )

• Лаборатория лазерной интерферометрии
• site Лаборатория лазерной интерферометрии
• January 2012 Лаборатория лазерной интерферометрии

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes
• About
• ConClus

Shades of Deep Purple (USA: Tetragrammaton 1968 ; Europe: EMI Parlaphone 1968 ; Japan: Polydor 1968) (CD) . Deep Purple's debut album, recorded very hastily. ... Tracks: . ... Wring That Neck (Blackmore/Lord/Simper/Paice) . ... All tracks written by Blackmore/Gillan/Glover/Lord/Paice . ... Painted Horse (Blackmore/Gillan/Glover/Lord/Paice) . ... Child in Time (Live, 690924) (Blackmore/Gillan/Glover/Lord/Paice) . ... Bonus tracks on Japanese CD: Lazy (edited) (Blackmore/Gillan/Glover/Lord/Paice) . ...

Еще в разделе: (Показать все результаты (>31) - shamolin2.imec.msu.ru/ )

... Lectures, Questions & Answers . ... Evgeny V. Antipov (Faculty of Chemistry, Moscow State University) New cathode materials for lithium batteries . Questions and Answers . ... Questions . Vladimir I. Feldman (Faculty of Chemistry, Moscow State University) Physics and chemistry of solvated electron . ... Galina A. Tsirlina (Faculty of Chemistry, Moscow State University) Diversity of electrochemistry: the specific problems of molecular models and their experimental verification . ...

Еще в разделе: (Показать все результаты (>17) - www.elch.chem.msu.ru/ )

... PhD student needed in the Institute of Physical Chemistry in Warsaw, Poland for a study involving mostly calculations and NMR measurements of strained hydrocarbons with unusual spatial structure. ... As can be seen in the webpage, the group is also involved in studies in supramolecular chemistry and, if interested, the student could also take part in this research. ... The entrance exam is based on "Physical Chemistry" by Atkins. ...

Еще в разделе: (Показать все результаты (>11) - www.chemport.ru/ )

... VAK Russian Federation . Keldysh institute of applied mathematics . ... Unitied Institute of Physics of the Earth named for O.Yu. Schmidt see also another site of this Institute . ... Moscow Meriya . Institute of Nutrition of the Russian Academy of Medical Sciences . MSU, Physics Department . ... Skobeltsyn Institute of Nuclear Physics of MSU , see also another site . P.N.Lebedev Physical Institute Russian Academy of Sciences . ... M.V. Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>16) - astrometric.sai.msu.ru/ )

• Other Russian Universities and Institutes
• ASTROMETRY DEPARTMENT of SAI
• Kozyreva Sasha's Bookmarks

Unix 2006 519.6 , . ... Unix. ... Unix, , , ; , Unix, Gnu ( gcc, gdb Gnu Make), . ... Unix' ; , , , , Windows, MacOS .. ... Ctrl-]. , , make (.ї4.3), vim , gcc. make vim. , make prog, vim :make prog. , , " " . ... grep , , find (. ... name "*.c" -exec grep include {} #include <fcntl.h> #include <sys/stat.h> ./hel.c #include "stdio.h" ./kr.c .. grep ( !) -print . ... name "*.cpp" -o -name "*.c" \) -exec grep main {} \; -print int main() ./kr.c int main() ./hel.c int main() ./kr.cpp , find, , , , Unix. ...

Еще в разделе: (Показать все результаты (>2) - al.cmc.msu.ru/ )

• http://al.cs.msu.ru/books/avst/unix.ps

... История кафедры . ... S. Auclair, R. Uzbekov, S. Elis, L. Sanchez, I. Kireev, L. Lardic, R. Dalbies-Tran, and S. Uzbekova. ... I. Vorobjev, K. Buchholz, P. Prabhat, K. Ketman, E. Egan, M. Marti, M. Duraisingh, and N. Barteneva. ... Belmont AS, Hu Y, Sinclair PB, Wu W, Bian Q, Kireev I. Insights into Interphase Large-Scale Chromatin Structure from Analysis of Engineered Chromosome Regions. ... Цитология, (2010), т. 52, ? ... Hu Y., Kireev I., Plutz M., Ashourian N., Belmont AS. ... 2008), 5(4):311...

Еще в разделе: (Показать все результаты (>3) - cytol.bio.msu.ru/ )

Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...

Еще в разделе: (Показать все результаты (>16) - swx.sinp.msu.ru/ )

... Head of Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University. Principal researcher, Kurnakov Institute of General and Inorganic Chemistry, RAS. ... 1950-1955 - student of Department of Chemistry, Lomonosov Moscow State University. ... Since 1978 - professor of Analytical Chemistry Division, Department of Chemistry, Lomonosov Moscow State University; since 1989 - head of the Division (half time). ... USSR State Prize (1972) . ... Moscow State University . ...

Еще в разделе: (Показать все результаты (>16) - analyt.chem.msu.ru/ )

• The Molecular Mechanic Approach to Coordination Compounds: Force Field Based on
• Molecular Mechanics Calculations of beta-Diketonate, Aqua, And

... Co-Chair , ICONO/LAT 2013 . Director, Institute of Laser Physics . ... Russia . ... Conference venue . Moscow, Russia . Program overview . Program topics . ... Advance program . ... Visa to entry Russia . ... ICONO/LAT conference is the leading event in the area of quantum electronics, laser physics, and their applications. ... You are greatly welcome to attend the ICONO/LAT 2013 conference in Moscow, Russia. ... International Laser Center, M.V.Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>9) - iconolat13.phys.msu.ru/ )

• Invited speakers

... General Information . ... For physics faculty . ... For natural faculties . ... Institute of General Physics RAN (Moscow) . ... Kazan State University (Kazan) . ... the science laboratories and group of the department have broad contacts with science and educational institutions around the globe: . ... Institute of Solid State Physics, Tokyo University . ... Institute of Solid State Physics, Vienna University of Technology . ... Institute of General Physics, Dresden Technical University, Germany . ...

Еще в разделе: (Показать все результаты (>10) - ferro.phys.msu.ru/ )

• Laboratory of Ferroelectricity

... О КАФЕДРЕ ? ... ОБЩАЯ ИНФОРМАЦИЯ О КАФЕДРЕ ? ... СОТРУДНИКИ КАФЕДРЫ ? ... Школа ЮНЕСКО / UNESCO SCHOOL . ... заведующий кафедрой ЮНЕСКО по изучению глобальных проблем факультета глобальных процессов МГУ имени М.В.Ломоносова . ... В настоящее время является заведующим кафедрой ЮНЕСКО факультета глобальных процессов МГУ имени М.В.Ломоносова. ... 2005-2013 Факультет глобальных процессов МГУ имени М.В. Ломоносова / Исполнение и поддержка ресурса: Союз молодых ученых и специалистов Евразии ...

Еще в разделе: (Показать все результаты (>4) - unesco.fgp.msu.ru/ )

• News from the UNESCO Chair on Global Problems Кафедра ЮНЕСКО по изучению
• ОБЩАЯ ИНФОРМАЦИЯ О КАФЕДРЕ ? GENERAL INFORMATION ABOUT THE CHAIR Кафедра ЮНЕСКО

pic] The Moscow Landscape: Architecture, Museums and Music. Course: 12 classes Fall semester, 2007 Dr. Olga Zinovieva Academy of National Economy Moscow is a huge metropolis of 10 million people with the life style typical to the most of big cities but at the same it has its unique flavor. ... The image of the city keeps changing but it has been closely connected with the political, economic and social background in Russia in general. ... Natasha's Dance : A Cultural History of Russia 17. ...

Еще в разделе: (Показать все результаты (>21) - suny.msu.ru/ )

... On the Institute . ... Development of relational methods of studying time [Chief: V.V. Aristov, Dr. Sci. (physics and mathematics)] . ... Physics of relic radiation, fundamental interaction mediator, carrier of space and time [Chief: I.M. Dmitrievsky, PhD (technology), Ass. ... Algebraic structure of space-time, algebrodynamics of fields and particles [Chief: V.V. Kassandrov, PhD (physics and mathematics)] . ... Causal mechanics [Chief: S.M. Korotaev, Dr. Sci. (physics and mathematics)] . ...

Еще в разделе: (Показать все результаты (>14) - temporology.bio.msu.ru/ )

• Уравнения динамики систем

M obile A stronomical Sy stem of TE lescope- R obots MASTER-II Kislovodsk Lomonosov Moscow State University, Sternberg Astronomical Institute , Moscow Union "Optic" , Kislovodsk Solar Station Latitude = 43 o  44'.767 N; Longitude = 42 o  31'.417 E; Altitude = 2067 m MASTER II (8 square degress) + MASTER VWF(Very Wide Field Cameras (FOV=800 square degrees, Time resolution up to 150 ms, with unfiltered m_lim=14m on 5 sec. exposure, and ~10.5m with 0.15 sec) . ... 11h 38m 38.0s , -09d 59m 59s) . ...