... Scientific conference . ... International recognition of this outstanding woman and scientist serves as a wonderful example for the young people who have chosen chemistry as the basis for the carrier, and makes it possible to commemorate the important contribution of women in the development of chemistry as a science.? ... Especially in Russia women received possibility of professional realization in chemical science and education through? different ways starting from 1870?s on. ...

Еще в разделе: (Показать все результаты (>100) - www.chem.msu.ru/ )

... We are engaged in conducting field summer practice for students of the 1st and the 2nd year of education at Zvenigorod Biological Station of MSU. ... Students of the 2nd year of education join the summer special practice course that is conducted in the form of expedition to various regions of Russia. ... The Department graduates 10-15 students each year. ... Field Practice at the White Sea Biological Station . About Department * Courses * Field Practice at the White Sea Biological Station . ...

Еще в разделе: (Показать все результаты (>61) - vertebrata.bio.msu.ru/ )

sparallel.ru . Older posts . Newer posts . Posted by admin . ... Continue reading . Posted in Разное . Мар 17 . ... В интернет-магазине Cityboots представлена последняя коллекция обуви от Fabi по доступной цене. ... Posted in Ботинки . ... Широко известный канадский бренд бюджетной мужской и женской обуви. ... Posted in Кросовки . ... Posted in Сандалии . ... совокупный доход, получаемый этими ?обуви? или ? ... Экологически чистая обувь, обувь которая ?дышит? ? ... обувь изо льна. ...

Еще в разделе: (Показать все результаты (>8) - sparallel.ru/ )

• sparallel.ru - Part 106

Optimization of electrospray ionization conditions for more informative mass spectra in structural research of HS for applications in medicine Mikhail A. Kazachkov1, Ivan V. Dubinenkov1, Alexey S. Kononikhin2,3, Igor A. Popov2,3, Irina V. Perminova1, Eugene N. Nikolaev2,3. ... The signal intensity was calculated as a summary intensity of 6 peaks from mass spectra, which were reproduced for each solvent and had high enough intensity even at not optimal conditions. ...

Еще в разделе: (Показать все результаты (>178) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf
• http://www.mgumus.chem.msu.ru/publication/2005/davidchik-laccase-05.pdf
• http://www.mgumus.chem.msu.ru/ihss/pdf/slovakia-2005.doc

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>134) - sp.cs.msu.ru/ )

• RAMPA - CASE for portable parallel programs development
• Lib-DVM. Preliminary design
• Explicit cyclic schemes for space neutron kinetics in (Hex-Z) geometry

ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>12) - www.cmc-online.ru/ )

The Laboratory of the Historical Information Science . ... The historical information science laboratory was founded within the structure of the source studies department on 8 December 1995 for the purpose of fulfilling the decision of the academic council of the History Faculty of 4 October 1991 about the transformation of a group for the application of mathematic methods and mainframes in historical research in the laboratory of historical information sciences. ... Senior laboratory assistant (2) . ...

Еще в разделе: (Показать все результаты (>4347) - www.hist.msu.ru/ )

• ЭОС истфака МГУ: Кафедра исторической информатики
• Instrumenta
• ЭОС истфака МГУ: Course categories

... Отдел культуры древности . Отдел культуры и науки средневековой Европы . Отдел христианской культуры . Отдел русской культуры . Отдел лингвокультурной экологии . Moscow State University . Institute of World Culture Moscow 119991 . ... Russian State University for the Humanities, October 2009. ... Linguistics and Near Eastern Studies. University of Chicago, June 2008. ... Linguistics. Russian State University for the Humanities, May 1996. ...

Еще в разделе: (Показать все результаты (>24) - imk.msu.ru/ )

• Институт мировой культуры МГУ

... Our primary objective is the design and implementation of applied software tools for data processing, output and circulation of computer literature. ... Software tools for signal processing in medicine and engineering CONAN-m and CONAN-t. Statistical stable analysis tool for regression and factor models SIGN. ... Figurnov V.A. "IBM PC for Users" (in Russian). ... Boldin M.V., Simonova G.I., Tyurin Yu.N. "Sign Statistical Analysis of Linear Models" (in Russian and in English ). ... InCo . ...

Еще в разделе: (Показать все результаты (>5) - statsoft.msu.ru/ )

... NetCDF User's Guide for C . Unidata ( http://www.unidata.ucar.edu ) is a National Science Foundation-sponsored program empowering U.S. universities, through innovative applications of computers and networks, to make the best use of atmospheric and related data for enhancing education and research. ... The Network Common Data Form (netCDF) software described in this guide was originally intended to provide a common data access method for the various Unidata applications. ...

Еще в разделе: (Показать все результаты (>59) - angel.cs.msu.su/ )

• ExtensionFileFilter
• : Class NetcdfFile
• NetCDF User's Guide for C

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

... April 9, 1999 . WR 104: Pinwheel Star . ... Explanation: Like a cosmic lawn sprinkler, dust streaming from a rotating star system creates a pinwheel pattern in this false color infrared image . Astronomers discovered the surprising star dust scenario using a sophisticated interferometer and the 10 meter Keck I telescope to observe the bright Wolf-Rayet star WR 104. ... The problem is, their starlight would also be so intense that any dust flakes should be destroyed! ... About APOD > . ...

Еще в разделе: (Показать все результаты (>132) - www.arcetri.astro.it/ )

• APOD: November 9, 1999 - Spiral Galaxies in Collision

... Graduated from M.Lomonosov Moscow State University, Department of Mechanics and Mathematics. Dissertation's title of Ph.D. (Phys.& Math): "Aerodynamic Characteristics, Shape-Formation and Stressed-Strained State of Parachute Canopy." ... Graduated from M.Lomonosov Moscow State University, Piano Class. ... Development of mathematical models and parameter computation methods for the shape, aerodynamic drag and stressed-strained state of parachutes with different canopy geometry. ...

Еще в разделе: (Показать все результаты (>11) - margaret.imec.msu.ru/ )

• Homepage
• Scientific Achievements

About BAFIZ . BAFIZ at SINP MSU . ... The main aims of the Project at SINP of MSU . ... Development of the Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE) at SINP of MSU . Development of the tools for Space Physics data utilization and processing . ... The communication infrastructure base of the Project at SINP of MSU is based on Radio-MSU Network . The computational base of the Project at SINP of MSU is Computing Center ALPHA . ...

Еще в разделе: (Показать все результаты (>26) - dbserv.sinp.msu.ru/ )

• Satellite Informations Sector
• ULYSSES Online Data Set Selector

Russian Journal of Electrochemistry, Vol. 37, No. 12, 2001, pp. ... CHRONICLE Yurii Aleksandrovich Chizmadzhev An outstanding Russian scientist, the corresponding member of the Russian Academy of Sciences Yurii Aleksandrovich Chizmadzhev marked his 70th birthday on December 15, 2001. ... In the Chizmadzhev laboratory, prime attention was devoted to an electroporation phenomenon, i.e. to the origination and development of micropores under the action of electric field. ...

Еще в разделе: (Показать все результаты (>79) - electr003.chem.msu.ru/ )

• Boris B. Damaskin
• Department of Electrochemistry
• Alexander M. Kuznetsov

... Issues of the year 2010 . Issues of the year 2011 . ... P.P.?Shirshov Oceanology Institute, Russian Academy of Sciences, and Hydrometeorological Research Center of Russia, Moscow, Russia . Phone: +7-495-687-5352 . ... Senior scientist, Faculty of Geography, M.V.Lomonosov Moscow State University, Moscow, Russia, Leninskie gory, 1, 1199911 . ... AEROSOL PROPERTIES IN MOSCOW ACCORDING TO 10 YEARS OF AERONET MEASUREMENTS AT THE METEOROLOGICAL OBSERVATORY OF MOSCOW STATE UNIVERSITY Abstract: . ...

Еще в разделе: (Показать все результаты (>452) - www.geogr.msu.ru/ )

• Фотографии юбилея
• Instructions for Authors, contributing to ?GEOGRAPHY, ENVIRONMENT,

The Lomonosov Moscow State University Faculty of Educational Studies The MSU FES offers various educational programs: 1. Master program "Education Management"; 2. ... Qualification training programs "School Teacher" and "Higher School Teacher". The FES was founded in 1997 with the main goal to teach those students of the MSU faculties who wished to receive the qualification of Secondary and Higher School teacher & lecturer in addition to their basic speciality. ...

Еще в разделе: (Показать все результаты (>2) - fpo.msu.ru/ )

Backlinks to VarSEARCH in all Webs ( Search System Web only ) . ... Overview Next to freeform topic contents, each topic can store .. NEW - 14 Mar 2011 - 23:35 by ProjectContributor . ... NEW - 23 Aug 2010 - 13:36 by ProjectContributor . ... NEW - 27 Feb 2011 - 20:56 by ProjectContributor . ... NEW - 03 Sep 2010 - 08:51 by ProjectContributor . ... Search Help Search basics By default a search looks into topic titles, topic texts and form fields in the current web. ... See SEARCH and QuerySearch .. ...

Еще в разделе: (Показать все результаты (>23263) - wiki.cs.msu.ru/ )

• (backlinks in System Web) VarSEARCH < System < Foswiki
• WebHome < Sandbox < Foswiki
• (backlinks in System Web) FAQForm < System < Foswiki

... Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. ...

Еще в разделе: (Показать все результаты (>213) - vestnik.math.msu.su/ )

... Data . ... Meteor-M тДЦ1 . ... Meteor-M тДЦ2 . ... Solar energetic particles . ... Solar flare database (RU) . ... Developers: David Parunakian, Wera Barinova, Oleg Barinov, Ludmila Mukhametdinova . Database administration: Sergey Bobrovnikov, Wera Barinova . Space physics models: Alexey Petrov, Rikho Nymmik , Boris Yushkov, Shugai Julia, Kuznetsov, Suvorova . ... Developed in 2007. Copyright ?й 2007 - 2016 Skobeltsyn Institute of Nuclear Physics Moscow State University Feedback ...

Еще в разделе: (Показать все результаты (>69) - smdc.sinp.msu.ru/ )

• Space Monitoring Data Center
• OMNIweb mirror - Space monitoring data center
• Space monitoring data center