This file is an archive of all of the changes which have been made to the Bright Supernovae pages in 1998 (which is when I started logging them). ... Added images from this page to the 1997cw and 1997cx entries. ... Added several images to the 1996 SN , 1997 SN , 1998 SN , 1998S , and 1998eg pages from "The Astronomer" mag Variables, Novae and Supernovae Images page. ... Added images to the 1998aq , 1998S , 1998bu , and 1998es web pages from a list of images on Laszlo Kiss's Latest images web page. ...

Еще в разделе: (Показать все результаты (>433) - www.rochesterastronomy.org/ )

• Supernova 2001V in NGC 3987
• Supernova 2007av in NGC 3279
• Supernova 2000ck in IC 4355

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>18) - lcc.chem.msu.ru/ )

... about ERC . education . research . events . ... Being an effective way of acquiring knowledge, they also make a good addition to core lecture courses and involve students, postgraduates and scientists of other Russian higher education institutions and research centers in ERC activity in the initial stage. ... More information can be found at http://polly.phys.msu.ru/ru/unc/sconf.html . ... Conference on Development Prospects of Education and Research Centers in the Russian Federation . ...

Еще в разделе: (Показать все результаты (>22) - nano.msu.ru/ )

• International School ?Computer simulation of advanced materials?, 16?21 July
• Registration for the International School ?Computer simulation of advanced

... Faculties . ... General Information . ... Study and Research . ... The Faculty has 18 departments: Department of General Mathematics , Department of Non-Linear Dynamic Systems and Control Processes, Department of Mathematical Physics, Department of Computational Methods, Department of Research Automation, Department of Operations Research , Department of Optimal Control, Department of System Analysis, Department of Mathematical Statistics, ...

Еще в разделе: (Показать все результаты (>104) - www.msu.ru/ )

• MSU Web Sites
• Faculty of Materials Science
• Faculty of Soil Science

... Поиск по МГУ | Лента новостей | ... О проекте . ... Please, enter the code that you see below in the input field. This is for blocking bots that try to post this form automatically. If the code is hard to read, then just try to guess it right. If you enter the wrong code, a new image is created and you get another chance to enter it right. ... 2003 2011 MsuNews.Ru Новости МГУ . 2003 2011 Разработка и дизайн MMForce.Net . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>87) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ
• MsuNews.Ru | Блог проекта
• MsuNews.Ru | Энциклопедия

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>21) - heritage.sai.msu.ru/ )

• А.В.Засов. Задача 13: Определение физических параметров газа в ядре

Вход в личный кабинет . ... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Подписаться на новости . Вакансии . ... Компания: Nielsen company . The Nielsen Company is a market-leading information & media company with more than 41,000 employees in 100+ countries around the world. ... Please send your CV before June 9th marked in Subject line Summer Internship Program at: RussiaMoscow.HR@nielsen.com or info.russia@nielsen.com . ...

Еще в разделе: (Показать все результаты (>133) - www.physcareer.ru/ )

• Supply Network Operations- Supply Chain Manager-CS 00001567, компания Procter /

Клуб выпускников МГУ (Московский Государственный Университет) . By national TV "NEW CHANNEL", UKRAINE. New quantum technology in the field of biocybernetics . ... NEW CYBERNETIC BODY WITH THE BEST QUALITY OF REAL LIFE. ... B контексте моей теории плазма, это не ионизированный газ, а форма материи, из которой состоит внутренняя структура частиц. ... NEW QUANTUM THEORY OF ATOM'S NUCLEUS PRESENTED BY THE AUTHOR, DR. KOSTIANTYN RASIN. ... NEW ERA OF QUANTUM TECHNOLOGIES JUST BEGUN.. ...

Еще в разделе: (Показать все результаты (>518) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Таблетка-чип, заменяющая врача. умная таблетка, smart...
• Клуб выпускников МГУ: Хотите жить дольше? 3 основных секрета
• Клуб выпускников МГУ: GlowByte

.

Еще в разделе: (Показать все результаты (>64) - lav01.sinp.msu.ru/ )

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ THE NEW GRIDDED KURIL-KAMCHATKA BATHYMETRY FOR TSUNAMI MODELING An. ... For calculations in each grid point where the depth is to be found the algorithm uses up to 9 points from data source. ... Then the spline interpolation is used for defining the depth value in the grid-point. ... Hydrographic Survey Data, CD-ROM data set, Ver. ...

Еще в разделе: (Показать все результаты (>23) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E09_Karlik.pdf

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>10) - polit.msu.ru/ )

• Новости факультета

... ECOLOGICAL COOPERATION" . ... Brjanskaja oblast, Dubrovskij rajon, Seshcha (village), School . Brjanskaja oblast, Djat'kovskij rajon, Bytosh (village), School . ... Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Borodino (village), School . Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Yardenikha (village), School . ... Moscow, Children's Ecological Center of the National Park "Losinyj Ostrov" - the coordinator of ecological work of 18 Korolev-town's schools . Moscow, School #222 . ...

Еще в разделе: (Показать все результаты (>28) - www.ecocoop.ru/ )

• For three and half years of activity the participants of Ecological Cooperation

... About the project . ... Biological information . As part of the project areas we will develop the scientific basis for the creation of infrastructure solutions and knowledge-based platforms for a comprehensive biodiversity study in Russia on the basis of genomic and storage technologies, analysis and exchange of data different types. ... Solution of problems set out in the project area will have the long-term effect in the various fields of science and engineering disciplines in the social sphere. ...

Еще в разделе: (Показать все результаты (>6) - depository.msu.ru/ )

• depozitariy | Living systems depository "Noah's Ark"
• Main grant | depozitariy

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

О кафедре . Сотрудники . ... Публикуем материалы сотрудников кафедры . ... Кафедра математических и компьютерных методов анализа создана приказом ректора МГУ в 2008 году. ... Сотрудники кафедры проводят научные исследования в следующих областях: аналитическая теория чисел, математический анализ, теоретико-числовые методы в криптографии, сложность вычислений, компьютерная криптография, компьютерная геофизика. ... 2016, Кафедра математических и компьютерных методов анализа. ...

Еще в разделе: (Показать все результаты (>3) - mkma.math.msu.su/ )

... Site is discontinually updating by professional biologists and students of biology faculty of MSU. ... Journals began from 'T' . ... Wiley Interscience ] . ... not defined] . ... The International Journal of Biochemistry Cell Biology . Elsevier Science ] . ... The Journal of Cell Biology . ... The Journal of Membrane Biology . ... The Journal of Steroid Biochemistry and Molecular Biology . ... Trends in Biochemical Sciences . Elsevier Current Trends ] . ... JCatalog | Journal list . ...

Еще в разделе: (Показать все результаты (>661) - journals.genebee.msu.ru/ )

• JCatalog >> Journal information >>
• JCatalog - Science Magazines Catalog

About BAFIZ . BAFIZ at SINP MSU . ... The main aims of the Project at SINP of MSU . ... Development of the Centre for Photonuclear Experiments Data (Centr Dannykh Fotoyadernykh Eksperimentov, CDFE) at SINP of MSU . Development of the tools for Space Physics data utilization and processing . ... The communication infrastructure base of the Project at SINP of MSU is based on Radio-MSU Network . The computational base of the Project at SINP of MSU is Computing Center ALPHA . ...

Еще в разделе: (Показать все результаты (>29) - dbserv.sinp.msu.ru/ )

• Satellite Informations Sector
• ULYSSES Online Data Set Selector

... Working channel dimensions: length - 1200 mm, width - 300 mm, height - 30 mm; 50mm. Air velocity range in a working channel: 5-120 m/s with a step 0,1 m/s. Mass air rate: 0,2-1,3 kg/s . ... Model/flow temperature difference: up to 120C . ... Aerodynamic unit 'SAU-Siemens' was created to investigate heat exchange intensification on the surfaces with complex relief (dimples, grooves, etc) in flat channels at subsonic flow of working medium (air). ...

Еще в разделе: (Показать все результаты (>7) - termogaz.imec.msu.ru/ )

• aboutLab

... Форумы > Разное > Тема . ... Работа в Microsoft . ... Резюме на английском можно направлять по адресу uwork@microsoft.com В Москве интервьюировать будут в конце Мая. ... Hа конкретные вопросы могу попробовать ответить по . ... Если этот этап пройден, то как правило назначают телефонное интервью. ... Ответить Цитировать . ... Someone that is very driven and passionate about technology, desiring to make software products that will go all over the world . ... Работа в Microsoft - 2005 . ...

Еще в разделе: (Показать все результаты (>6769) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура
• MMOnline | Форумы | Разное
• MMOnline | Форумы | Первокурсникам

... The given course consisting of lectures and seminars is aimed at teaching our students a whole range of measures, which allow quick and efficient faultfinding, functional testing, reliability testing of a device, find replacement for a faulty component at the modern technological level, fix a device, create a similar device even without the blueprints. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ...

Еще в разделе: (Показать все результаты (>73) - engineering.phys.msu.ru/ )

• Introduction to Linux