... 5) Two variant of calculation: Main 1 (absence of SNRs in the Earth vicinity with Emax =4 PeV ) and Main 2 (where 4 SNRs accelerate to 4 PeV ) give more or less similar structures around the knee Here we need to know MetaGalactic Sum Gal+Metag 025 0.20 · 10 7 · F(E) E 10 6 P He 3 .0 Fe · 10 5 C,O Si Pure Galactic · 10 4 10 4 10 5 10 6 10 7 10 8 10 9 10 10 10 11 10 12 E, GeV Contribution of nearby actual sources 10 1 Main 2 all p he cno si fe nearby ...

Еще в разделе: (Показать все результаты (>8) - tunka.sinp.msu.ru/ )

• http://tunka.sinp.msu.ru/en/presentation/Dedenko.pdf
• http://tunka.sinp.msu.ru/en/presentation/horns_vhe.pdf

... -department of Environmental Technology, Wageningen University, PO Box 8129, 6700 EV Wageningen, The Netherlands Keywords Mathematical model ф Upflow anaerobic sludge bed reactor ф Dispersion ф Plug flow ф Sedimentation Nomenclature Coefficients in empirical equations A AC Ash content of the dry sludge aggregates (%) b Bacterial (death+lysis) rate coefficient ( dayю1 ) COD Chemical oxygen demand (g) CS ... Narnoli SK, Mehrotra I (1997) Sludge blanket of UASB reactor: mathematical...

Еще в разделе: (Показать все результаты (>126) - www.enzyme.chem.msu.ru/ )

• PubMed medline query

... In a sphere-plane geometry, routinely used in atomic force microscope and surface force apparatus, it can form a bridge connecting the surfaces. ... By minimizing the free energy of a binary mixture we obtain the force-distance curves as well as the structural phase diagram of the configuration with the bridge. Numerical results predict a discontinuous transition between the states with and without the bridge and linear force-distance curves with hysteresis. ... Phys., Vol. ...

Еще в разделе: (Показать все результаты (>29) - nanofluidics.phys.msu.ru/ )

• http://nanofluidics.phys.msu.ru/paper/jcp2008.pdf
• http://nanofluidics.phys.msu.ru/paper/LA026419f2.pdf
• http://nanofluidics.phys.msu.ru/paper/pre2006e.pdf

... A comparative study of thermodynamic for both natural and artificial RNA/DNA ­ protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA ­ protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...

Еще в разделе: (Показать все результаты (>8) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/nar2004.pdf

... The circular sidewall of the layer was made of plexiglass. ... This is in contrast to the situation of horizontal layer where longitudinal magnetic field doesn't influence on convective instability and only renders oriented effect [8,10]. [ pic ] Figure 6 Stability boundaries of thermally driven shear flow in an inclined ferrofluid layer in the presence of a longitudinal magnetic field : a - shear flow ; b - convection rolls aligned with the shear flow ; c - convection ...

Еще в разделе: (Показать все результаты (>20) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2006/CD/BozhkoAAPutinGF.pdf
• http://hit-conf.imec.msu.ru/books/NeZaTeGiUs_2010.pdf

... Research objects and scientific purposes . Space scientific program includes development and launch of two supersmall spacecrafts "Universitetskiy" and "Kompas-2" intended for monitoring of radiation conditions near the Earth. ... All the studies conducted in the near-Earth space are characterised by strong radiation fields. ... The circular polar orbits, which cover all the near-Earth space, are the most favorable for comprehensive studies of the radiation conditions near the Earth. ...

Еще в разделе: (Показать все результаты (>54) - cosmos.msu.ru/ )

Next: State of development Up: Guided tour through MICO Previous: Guided tour through MICO . Modern programming languages employ the object paradigm to structure computation within a single operating system process. The next logical step is to distribute a computation over multiple processes on one single or even on different machines. ... The Common Object Request Broker Architecture (CORBA) is a specification of such a middleware platform by the Object Management Group (OMG) (see [ 5 ]). ...

Еще в разделе: (Показать все результаты (>676) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QImageIO Class
• Linux Astronomy HOWTO
• Qt Toolkit - qimage.h include file

Chlorophyll Fluorescence in vivo : A Theory (Part I) . Most part of the photosynthetic pigments in phytoplankton cell reside in peripheral pigment-protein complexes of the light-harvesting antenna (I, see Fig. ... From peripheral antenna complexes, excitation is efficiently transferred to core antenna complexes near photosynthetic reaction centers (II, Fig. 1), where it can be used in the primary photochemical reaction of photosynthesis. ... and phytoplankton concentration . ...

Еще в разделе: (Показать все результаты (>20) - www.biophys.msu.ru/ )

• MEASURING THE PHYTOPLANKTON PHOTOSYNTHESIS RATE USING A PUMP-AND-PROBE
• (Chlorophyll Fluorescence in vivo: A Theory
• Сектор информатики и биофизики сложных систем

... M81 и M82 в поле зрения GALEX . ... Пояснение: Замечательная пара галактик M81 и M82 сияет на этом изображении - полном поле зрения орбитальной обсерватории GALEX. ... На этом изображении в искусственных цветах молодые звезды с возрастом меньше 100 миллионов лет выглядят голубыми, они явно отделены от более старых желтоватых звезд ядра галактики. Около верхнего края картинки видна неправильная галактика M82 , которая показывает результаты экстремальной частоты рождения и смерти звезд. ...

Еще в разделе: (Показать все результаты (>330) - www.nature.web.ru/ )

Links to DC resistivity and IP software in WWW ] . IPI2win is a program for 1D automatic and manual interpretation of VES curves. VES curves could be received with different arrays: Schlumberger , Wenner , dipole-dipole , pole - pole . ... You could change parameters of model in different ways: . ... on resistivity cross-section; . drag-and-drop the part of resistivity curve (blue). Simultaneously You could see how new parameter fits with field curve and another models of profile. ...

Еще в разделе: (Показать все результаты (>97) - www.geol.msu.ru/ )

• Faculty of Geology >> Geology at Moscow State University

Article pubs.acs.org/JPCC Diamond- Water Coupling Effects in Raman and Photoluminescence Spectra of Nanodiamond Colloidal Suspensions Tatiana A. Dolenko,*, Sergey A. Burikov, Jessica M. Rosenholm, Olga A. Shenderova, and Igor I. Vlasov § Physical Department, Moscow ... of Sciences, Moscow 119991, Russia ABSTRACT: The interaction of nanodiamond (ND) particles produced by detonation synthesis with water molecules in ND water suspensions was studied using ... Figure 2. ... Article Figure 6. ...

Еще в разделе: (Показать все результаты (>25) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/Assets/Water/ResLet2008.pdf
• http://rswater.phys.msu.ru/en/articles/2015/PSS.pdf
• http://rswater.phys.msu.ru/en/articles/before%202008/OptSpec2005.pdf

... A Primer from the Reform of Personal Income Taxation in Russia Introduction. ... However, to use the welfare function one needs to aggregate individual preferences that can also be unknown. ... The derivations lead to the conclusion that the optimal marginal income tax rate is increasing as the elasticity of labor supply increases. ... In this paper we obtain the characteristics of the labor supply for different population groups to get the elasticities of labor supply with respect to a post tax...

Еще в разделе: (Показать все результаты (>8) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./briedis.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>30) - mailybaev.imec.msu.ru/ )

• Book review by Professor Wolfhard Kliem

J/AstL/vol/page SAI Open Clusters Catalog (Glushkova+, 2009) ================================================================================ Automated search for star clusters in large multiband surveys. ... Color excesses E(B-V), distance moduli and ages were determined for 141 new and 27 known, but poorly studied clusters. We present the Sternberg Astronomical Institute Open Clusters Catalog (SAI OCL Catalog) of coordinates, diameters and main physical parameters of these clusters. ...

Еще в разделе: (Показать все результаты (>4) - ocl.sai.msu.ru/ )

• SAI Open Star Clusters (SAI OCL) Catalog
• SAI OCL Catalog Description
• SAI OCL Catalog Structure

Electron Paramagnetic Resonance Plan (1) Principle of the EPR method (a) history of the EPR method discovery (b) mechanic and magnetic moments of electron (c) Zeeman's effect (d) resonance basic equation (2) EPR spectra characteristics (a) amplitude (b) line shape (c) line width (d) superfine structure (3) Scheme of an EPR radiospectrometer (4) EPR application in medical biological investigations (e) natural ... Among such radicals, nitroxyl radicals became the most popular. ...

Еще в разделе: (Показать все результаты (>31) - foroff.phys.msu.ru/ )

• Postdoctoral training (Neutronography)
• Postdoctoral training (Cosmic Rays and Physics of Space)
• Выпускники 1968 A web page that points a browser to a different page after 5

... Лаборатория теоретической биофизики . ... ERG group members work with different types of molecules and consequently added new atomtypes into classical OPLS-AA distributed with GROMACS. ... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... All-atom automatic OPLS-AA topology generator . ... comcon1 in All-atom automatic OPLS-AA topology? . ... OPLS-AA? in All-atom automatic OPLS-AA topology? ... 2015 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>59) - erg.biophys.msu.ru/ )

• topology ERG Research Group: Лаборатория теоретической биофизики
• comcon1 ERG Research Group: Лаборатория теоретической биофизики
• Using RESP with GAMESS-US and Firefly (PC-GAMESS) ERG Research Group:

... Paradigm shifts by Kuhn: successive change of one model by another, rather than integration of different paradigms Progress of science: from single- to multi-model approach Some examples from natural science... · theory of light: from vibration of ether to wave-particle duality · laws of motion: from Newton's dynamics to SchrЖdinger 's and Heisenberg's formalism In social and environmental sciences appreciation of the multi-model ...

Еще в разделе: (Показать все результаты (>9) - oc.cs.msu.ru/ )

... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...

Еще в разделе: (Показать все результаты (>5) - angel.cmc.msu.ru/ )

Photo-induced delayed luminescence ( DL ) following a visible light excitation in air-dry seeds of various plants has been observed. ... The shape of DL distribution curve depends on homogeneity of seed population. ... Veselova, T.V., Veselovskii, V.A., Rubin, A.B., Bochvarov, P.Z. Delayed luminescence of air-dry soybean seeds as a measure of their viability. ... Veselova, T.V., Veselovsky, V.A., Kozar, V.I., Rubin, A.B. Delayed luminescence of soybean seeds during swelling and accelerated aging. ...

Еще в разделе: (Показать все результаты (>7) - biophys.msu.ru/ )