Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>6) - mph.cmc.msu.ru/ )

Hybrid States of Surface and Tamm Plasmon-Polaritons in Photonic Crystals B.I. Afinogenov, V.O. Bessonov, I.V. Soboleva, and A.A. Fedyanin Lomonosov Moscow State University, 1 Leninskie gory, 119991 Moscow, Russia afinogenov@nanolab.phys.msu.ru Abstract: Experimental observation of Tamm plasmon-polariton (TPP) and surface plasmonpolariton (SPP) hybrid mode in metal/photonic crystal system is reported. Interaction bet ween TPP and SPP leads to repulsion of their dispersion curves. ...

Еще в разделе: (Показать все результаты (>67) - nanolab.phys.msu.ru/ )

• Ultrafast plasmonics and magnetoplasmonics | Laboratory of Nanophotonics &
• Ultrafast magnetophotonics | Laboratory of Nanophotonics & Metamaterials
• Students can now use the homework download system and track their current

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>5471) - monkey.belozersky.msu.ru/ )

• About this project
• Homeodomain numeration assumed
• HF clusters: algorithm

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>261) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Конкурс российско-голландских проектов 2005 года.
• Клуб выпускников МГУ: Конференция "Вакансии"
• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>4) - tex.bog.msu.ru/ )

... Control question . Control answer . GEA is a system for the analysis of micro-array experiments results. It includes modules for background correction an normalization ( NM stage ), principal component analysis ( PCA stage ), clusterization ( CL stage ), quality control ( QC stage ), and main vector determination ( MV stage ). ... It is based on the evaluation of eigenvalues and eigenvectors in the gene space and the analysis of eigenvectors that correspond to the greatest eigenvalues. ...

Еще в разделе: (Показать все результаты (>176) - www.genebee.msu.ru/ )

• razjivin_dept
• Impact Factors of Scientific Journals in 1999
• MUSCLE User Guide

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ­ velocity potential, H ­ depth, ­ vector of bottom deformation, 0 ­ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>19) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/stathyd/2005%20Smyth%20et%20al.%2C%20Differential%20diffusion%20in%20breaking%20Kelvin-Helmholtz%20billows.pdf
• http://ocean.phys.msu.ru/courses/geo/lectures-addons/02/2006%20Wood%20et%20al.%2C%20Accretion%20of%20the%20Earth%20and%20segregation%20of%20its%20core.pdf
• http://ocean.phys.msu.ru/courses/geo/lectures-addons/15/2001%20Demorest%2C%20Dynamo%20theory%20and%20Earth's%20magnetic%20field%20.pdf

... The kinetics of the ESR signal from P700 (ESR signal I) was recorded at different concentrations of exogenous ferredoxin, ,A kinetic model was developed for ferredoxin-dependent cyclic electron transport around photosystem I. A multiparticle model was built to directly describe electron transfer in multienzyme complexes and restricted diffusion of mobile carriers in individual compartments (stroma, lumen, intramembrane space) of the system. ... Ferredoxin Lumen Photosystem I Plastocyanin Fig. ...

Еще в разделе: (Показать все результаты (>37) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3344.pdf
• http://library.biophys.msu.ru/matorin/3394.pdf
• http://library.biophys.msu.ru/PDF/3340.pdf

Space Weather Research in China and Introduction of CSSAR J. Cao (E-mail: jbcao@center.cssar.ac.cn) 1. ... Some important parameters of space environment are obtained, such as high energy charged particles (electrons, protons and heavy ions), single event upset, radiation dose, space plasma, surface charging, deep dielectric charging, upper atmosphere density and components, solar electromagnetic radiation and etc. ... The particle detectors soon detected the solar high energy particle fluxes. ...

Еще в разделе: (Показать все результаты (>15) - dbserv.sinp.msu.ru/ )

Prof. A.Nekipelov Moscow School of Economics , Moscow State University Lomonosov The Concepts of Economic Growth and Economic Development: Standard Macroeconomics and Pure Economics Approaches A Lecture Presented on January 31, 2011 at the International School f or Students Organized by IASSA and Department of Computational Mathematics and Cybernetics, MSU Lomonosov Economic Growth and Its Measurement by ... This distinction is applicable to the field of economic investigation. ...

Еще в разделе: (Показать все результаты (>17) - www.mse-msu.ru/ )

MSU . ... Every year since 2004, the MSU Science Park has conducted an educational program and an innovation project competition called Success Formula (www.successformula.ru). ... In collaboration with the Center of Technology Transfer at Moscow State University and the Chair of Innovation Economics, MSU Science park offers a wide range of educational programs like Success Formula as well as infrastructure projects geared to the incubation of new technology companies on the Moscow University site. ...

Еще в разделе: (Показать все результаты (>6) - www.sciencepark.ru/ )

... Possible constructions of reaction layers are compared, and the potential region in which continuous tungstate layer can be considered as a salt-like interlayer with barrier properties is singled out. ... In this communication, we report the tungstate effects on a number of electrode reactions on mercury and present the assumptions concerning possible structures of reaction layers at tungstate-modified surfaces. ... 0.2 V which can be attributed to some restructuring of adlayer. ...

Еще в разделе: (Показать все результаты (>106) - electr003.chem.msu.ru/ )

• Nanostructured SnO2-TiO2 films as related to lithium intercalation
• Pronkin Sergey Nikolayevich
• Electrocatalytic effects in gas sensors based on low-temperature superprotonics

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ­ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... LOMONOSOV MOSCOW STATE UNIVERSITY MAJOR GOAL OF IHSS-14 Expand the existing attitude towards humic substances as components of organic matter in soil and water to understanding their potential as alternative sustainable feedstocks for the chemical industry. ... LOMONOSOV MOSCOW STATE UNIVERSITY GAPS IN THE KNOWLEDGE -2 · IDENTITY CRISIS OF HUMIC SUBSTANCES: CLASSIFICATION OF HS AS CARBON FEEDSTOCK FOR DIFFERENT INDUSTRIAL NEEDS IS NEEDED To apply humic substances, we will need to classify them. ...

Еще в разделе: (Показать все результаты (>138) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-vladimirov-combination.pdf
• http://www.mgumus.chem.msu.ru/publication/2008/2008-vladimirov-comparison.pdf
• http://www.mgumus.chem.msu.ru/publication/2007/shcherbina-reduction-2007.pdf

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia e­mail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the so­called V­ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY Y­MP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>7) - asa.guru.ru/ )

Special courses for the students of Physics Faculty, specialized at the Department. ... 32 hours, 6-th term . ... A review of characteristic ferroelectric and magnetic materials is given. ... The anomalies of physical properties in the phase transition in accordance with the crystal symmetry. ... Solid state physics . ... It is assumed that student will get knowledge about magnetic properties of such systems as molecular, clusters, nano-particles, surfaces, ultra thin films, mono- and multilayers. ...

Еще в разделе: (Показать все результаты (>13) - ferro.phys.msu.ru/ )

... Master's Programme . ... On-line консультант . ... Master s Programme Enterprise Resource Management System has been developed basing on methodology from SAP, Oracle, Microsoft Companies, as well as the experience of national higher school and international universities. The key objective (mission) of the Programme is to educate professionals in the organization and implementation of projects aimed at deployment and maintenance of ERP systems at domestic enterprises. ...

Еще в разделе: (Показать все результаты (>7) - erp.cmc.msu.ru/ )

... The Self-propulsion of a Body with Moving Internal Masses in a Viscous Fluid Evgeny V. Vetchanin1* , Ivan S. Mamaev2, 1 3, 4 ** , and Valentin A. Tenenev1 *** Izhevsk State Technical University ul. ... His formula for resistance (drag) force is 1 (1) F = V 2 SCD , 2 where V is the velocity, is the density of the fluid, S is the midsection and CD is the coefficient of resistance. ... Section 2 presents a mathematical model describing the motion of a body with internal masses and a fluid surrounding...

Еще в разделе: (Показать все результаты (>122) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/972/RCD752.pdf
• http://ics.org.ru/upload/iblock/8b0/187-the-dynamics-of-vortex-rings-leapfrogging-choreographies-and-the-stability-problem_ru.pdf
• http://ics.org.ru/upload/iblock/250/188-an-extended-hamilton-jacobi-method_ru.pdf

... Antal , T.K., Volgusheva , A.A., Kukarskih , G.P., Krendeleva , T.E., Rubin, A.B. Relationships between H 2 photoproduction and different electron transport pathways in sulfur-deprived Chlamydomonas reinhardtii (2009) International Journal of Hydrogen Energy, 34, pp. ... Antal , T.K., Volgusheva , A.A., Kukarskikh , G.P., Krendeleva , T.E., Tusov , V.B., Rubin, A.B. Examination of chlorophyll fluorescence in sulfur-deprived cells of Chlamydomonas reinhardtii (2006) Biofizika ., 51 (2), pp. ...

Еще в разделе: (Показать все результаты (>9) - biophys.msu.ru/ )

• One of the informative characteristics of the reverse electron transport in the
• CURRICULUM VITAE