Cell Biology International 27 (2003) 293­294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...

Еще в разделе: (Показать все результаты (>37) - cellmotility.genebee.msu.ru/ )

Russian version . ... Leninskie Gory 1, Moscow, 119991, Russia . ... The title is: "The development of resonant X-ray reflectivity method near the L2,3 absorption edges for investigations of magnetic multilayers". ... Moscow. ... Russia. ... A. Smekhova, е.ю. Gan'shina, B.S. Roschin, A.D. Gribova, M.A. Andreeva, F. Wilhelm, A. Rogalev, "Structural and Magnetic Studies of [Co 0.45 Fe 0.45 Zr 0.1 /a-Si] N Multilayers", Journal of Spintronics and Magnetic Nanomaterials, 1 (1), pp.11-17 (2012) [pdf] . ...

Еще в разделе: (Показать все результаты (>963) - magn.phys.msu.ru/ )

• Information about education on magnetism division
• DETI.2 : joint HZDR - RFBR project

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Michael L. Gorodetsky . ... M.V.Lomonosov Moscow State Universitry , . ... 1991 -- 1997: research fellow, chair of Molecular physics and physics of measurements, faculty of Physics, Moscow State University . 1997 -- 2001: senior research fellow, chair of Molecular physics and physics of measurements, faculty of Physics, Moscow State University . 2002 -- 2007: leading research fellow, chair of Physics of oscillations, faculty of Physics, Moscow State University . ... Current research grants: . ...

Еще в разделе: (Показать все результаты (>94) - hbar.phys.msu.ru/ )

The Lomonosov Moscow State University Faculty of Educational Studies The MSU FES offers various educational programs: 1. Master program "Education Management"; 2. ... Qualification training programs "School Teacher" and "Higher School Teacher". The FES was founded in 1997 with the main goal to teach those students of the MSU faculties who wished to receive the qualification of Secondary and Higher School teacher & lecturer in addition to their basic speciality. ...

Еще в разделе: (Показать все результаты (>3) - fpo.msu.ru/ )

. Область научных интересов . Сотрудники, приглашенные специалисты и студенты . Информация о научных конференциях и семинарах . Основные публикации . Наш адрес . Home page .

Еще в разделе: (Показать все результаты (>30) - www.srcc.msu.ru/ )

... Moscow State University Russian Language Centre . ... The University of Nebraska-Lincoln Russian Club and the Department of Modern Languages and Literatures hosted Russian Night, the last event of Russian Week, at the UNL Culture Center. (more.. ... The international scientific conference " The Humanity and the environment " was held on 26-28 October, at the Moscow М.В. Lomonosov State University.The Conference was organized in partnership with State university of New York (SUNY). (more.. ...

Еще в разделе: (Показать все результаты (>25) - www.rlcentre.com/ )

Федеральное государственное Образовательное учреждение высшего Профессионального образования «Московский Государственный Технический Университет Гражданской Авиации» (МГТУ ГА) Кронштадтский бульвар 20, Москва, А-493, ГСП-3, 125993 Тел. ... Квалификации выпускников: "бакалавр техники и технологии", срок обучения 4 года; "магистр техники и технологии", срок обучения - 6 лет; инженер, срок обучения - 5,5 лет. ... Квалификация выпускника: инженер, срок обучения - 5 лет. ...

Еще в разделе: (Показать все результаты (>43) - genphys.phys.msu.su/ )

... Hyper-Rayleigh scattering in nongomogeneous thin films and interfaces . ... N.V. Didenko , B.P. Antonyuk, N.N. Novikova, and O.A. Aktsipetrov , Light-induced c -nonlinear susceptibility and its 1/ w fluctuations in silica glasses, Phys. Lett. ... N.V. Didenko , A.A. Fedyanin, E.P. Lukashev, and O.A. Aktsipetrov, Nonlinear interferometry of second-harmonic generation and hyper-rayleigh scattering from thin inhomogeneous films, IQEC ’98 [San Francisco, USA, 1998, Technical Digest, p. 111-112]. ...

Еще в разделе: (Показать все результаты (>44) - shg.phys.msu.ru/ )

• CURRICULUM VITAE
• Intro
• TATIANA VLADIMIROVNA MURZINA

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>4) - physcontrol.phys.msu.ru/ )

... О хоре . История хора . ... Выступление Академического хора МГУ в Крокус Сити Холле . ... Епископ Тихон открыл выступление хора МГУ в Вене . Хор МГУ выступил в Венском отделении ООН . Выступление хора на торжественном открытии Международного научного конгресса ?Глобалистика ? 2015? ... Академический хор Московского государственного университета имени М. В. Ломоносова . ... Прослушивания состоятся в течение всего сентябряљв 311 и 316 классах Культурного центра МГУ в 18-30 . ...

Еще в разделе: (Показать все результаты (>2) - choir.msu.ru/ )

... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...

Еще в разделе: (Показать все результаты (>2) - phys.msu.su/ )

... Faculty of Physics . ... Divisions Chairs . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...

Еще в разделе: (Показать все результаты (>11) - www.phys.msu.ru/ )

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>4) - www.edst.msu.ru/ )

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>34) - mailybaev.imec.msu.ru/ )

• Dr Alexei A. Mailybaev
• Book review by Professor Teodor M. Atanackovic

... Laboratory "Сryoelectronics" . Currently our group is working atљ experimental љstudying of nanoelectronic devices based on silicon, mostlyљsilicon nanowires and single-electron transistors. ... Suspended single-electron transistor made up from highly doped silicon on insulator (Laboratory of Cryoelectronics 2012)љ . ... E: This email address is being protected from spambots. You need JavaScript enabled to view it. P: +7 (495) 939-39-87 . ... 2016 Laboratory "Сryoelectronics" ...

Еще в разделе: (Показать все результаты (>37) - cryolab.phys.msu.ru/ )

• Nikolay V. Porokhov
• Alexander G. Maresov
• Eduard E. Levin

... The meeting with students of the 1st course on Physical specialist higher education program took place on May 28 2014 at Laboratory H16, Physical faculty, Moscow State University. Lecturers reported to the students some facts about the educational and science opportunities of the laboratory staff and also recounted their own investigation directions. Also the presentation, which have described the science efforts of the laboratory staff students was shown during the meeting. ...

Еще в разделе: (Показать все результаты (>83) - engineering.phys.msu.ru/ )

• Russia Today channel about us
• Parallel Programming
• How can I get there

... He was graduated from Moscow State University, Faculty of Mechanics and Mathematics, and post-graduate course in a speciality Theory of Probabilities and Mathematical Statistics. ... Ph.D in mathematics in 1980 (Moscow State University, Faculty of Computer Science). ... Author of Popular Textbooks on Data Analysis and Statistics. ... He was graduated from Moscow State University in 1980. Ph.D in mathematics in 1988 (Moscow State University, Faculty of Mechanics and Mathematics). ... InCo . ...

Еще в разделе: (Показать все результаты (>6) - statsoft.msu.ru/ )

• InCO General Information In English

... Leading Research Associate (MSU) . ... Graduated from the Moscow State University, 1960 . PhD, Moscow State University, 1970 . Doctor of Sciences, Moscow State University, 1995 . ... Type of Research: experiment . Research Interests: . ... Graduated from the Moscow Institute of Chemical Technology, 1954 . PhD, Moscow Institute of Chemical Technology, 1958 . Doctor of Sciences, Moscow Institute of Chemical Technology, 1981 . ... Type of Research: experiment, theory . ...

Еще в разделе: (Показать все результаты (>5) - newcryst.phys.msu.ru/ )

• Search of novel crystalline materials

... Professional experience . ... Department of Geology. Chair of Dynamic Geology. ... Laboratory of Geodynamic Processes Modeling. ... 2001 Elaboration (together with V.Vadkovsky ) electronic version of textbook on course "Dynamic Processes in Geology" for students of 5th course and postgraduate students (MSU. ... 2000 - Delivering lectures and performing exercises with students on the course "Computer Simulation Of Geodynamic Processes" for students of 3rd course (MSU. ... Page design: їV.Zakharov . ...

Еще в разделе: (Показать все результаты (>29) - dynamo.geol.msu.ru/ )